LXL04_013472 | RubberDandelionOmics

Gene overview

LXL04_013472

Reference: OH-1004 Chr: Chr03 Coordinates: 30120491-30122722 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1221 bp · LXL04_013472|LXL04_013472|OH1004|cDNA

ATGTGTCGGCTGCGAAGCTTCACTGAAGATATGAAGTCCACAGTTACCCATACCGTCGGCAATGACACGAGACGGAGAAGCTCCGGTATTGTTTCTCCGGTCACAATTTCTCAGTTTCTGTCACCATCGGAATCCTTCAATTGCGATATTAAAGATGCTGCTAGTGAAACTTATTTAATCCTTCATCTTATTTTTACTCTCATCCGCTATCTCGGGGTAGGCCGCCGAAGTATGTTGAGGGCTGTTTCCCTCGTGGTTTA...

CDS

Download CDS FASTA

1221 bp · LXL04_013472|LXL04_013472|OH1004|CDS

ATGTGTCGGCTGCGAAGCTTCACTGAAGATATGAAGTCCACAGTTACCCATACCGTCGGCAATGACACGAGACGGAGAAGCTCCGGTATTGTTTCTCCGGTCACAATTTCTCAGTTTCTGTCACCATCGGAATCCTTCAATTGCGATATTAAAGATGCTGCTAGTGAAACTTATTTAATCCTTCATCTTATTTTTACTCTCATCCGCTATCTCGGGGTAGGCCGCCGAAGTATGTTGAGGGCTGTTTCCCTCGTGGTTTA...

Protein

Download Protein FASTA

406 aa · LXL04_013472|LXL04_013472|OH1004|PROTEIN

MCRLRSFTEDMKSTVTHTVGNDTRRRSSGIVSPVTISQFLSPSESFNCDIKDAASETYLILHLIFTLIRYLGVGRRSMLRAVSLVVYTTLILPGLLKVAYQYCLSTHVRRSVMYGDQPRNRLDLFLPKDKDGLKPVVVFVTGGAWMIGYKGLGALLGLPLADRDIMVASLDYRNYPQGTISDMVEDVSQGISFVCKNIAEYGGDPNRIYVMGQSAGAHISSYVILRQAIKESKGEAISWSVSQIKAYFGLSGVYNLPPLV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013472`
TK1151 ID	TkA02G494440
OH-1004 ID	LXL04_013472
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013472

Location Chr03:30120491-30122722 (+)

Description Similar to ICMEL2: Probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g02410`	Catalyzes the demethylation of isoprenylcysteine methylesters (By similarity).	Characterization, sub-cellular localization and expression profiling of the isoprenylcysteine methylesterase gene family in Arabidopsis thaliana.2010 · DOI: 10.1186/1471-2229-10-212
`At5g15860`	Catalyzes the demethylation of isoprenylcysteine methylesters.	Prenylcysteine methylesterase in Arabidopsis thaliana.2006 · DOI: 10.1016/j.gene.2006.05.023 Isoprenylcysteine methylation and demethylation regulate abscisic acid signaling in Arabidopsis.2008 · DOI: 10.1105/tpc.107.053389 Characterization, sub-cellular localization and expression profiling of the isoprenylcysteine methylesterase gene family in Arabidopsis thaliana.2010 · DOI: 10.1186/1471-2229-10-212
`At1g26120`	Catalyzes the demethylation of isoprenylcysteine methylesters (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0708100`	Catalyzes the demethylation of isoprenylcysteine methylesters.	No verified direct reference in this release
`Os05g0577200`	Catalyzes the demethylation of isoprenylcysteine methylesters.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013472 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009737 response to abscisic acid Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0010296 prenylcysteine methylesterase activity Molecular Function

KEGG gene cross-reference

ath:AT1G26120

ath:AT3G02410

ath:AT5G15860

dosa:Os05g0577200

dosa:Os06g0708100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.412

Rank 1 · LXL04_013472 · OH-1004

Golgi apparatus0.190

Rank 2 · LXL04_013472 · OH-1004

Cytoplasm0.169

Rank 3 · LXL04_013472 · OH-1004

Lysosome / Vacuole0.143

Rank 4 · LXL04_013472 · OH-1004

Nucleus0.128

Rank 5 · LXL04_013472 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20434.6BD-FAE122-330 aa

PF00135.35COesterase122-244 aa

PF07859.20Abhydrolase_3137-348 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013472	`PF20434.6`	BD-FAE	122	330	4.7e-27	95.6
LXL04_013472	`PF00135.35`	COesterase	122	244	1.7e-14	54.4
LXL04_013472	`PF07859.20`	Abhydrolase_3	137	348	7.2e-13	49.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q1PET6`	Arabidopsis thaliana	Probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL2	61.880%	Swiss-Prot	strong database homology
`Q94AS5`	Arabidopsis thaliana	Isoprenylcysteine alpha-carbonyl methylesterase ICME	61.856%	Swiss-Prot	strong database homology
`Q8VYP9`	Arabidopsis thaliana	Probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1	53.218%	Swiss-Prot	strong database homology
`Q5Z9I2`	Oryza sativa subsp. japonica	Probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1	57.143%	Swiss-Prot	strong database homology
`Q6L5F5`	Oryza sativa subsp. japonica	Probable isoprenylcysteine alpha-carbonyl methylesterase ICME	55.801%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card