LXL04_013440 | RubberDandelionOmics

Gene overview

LXL04_013440

Reference: OH-1004 Chr: Chr03 Coordinates: 29704588-29707309 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1627 bp · LXL04_013440|LXL04_013440|OH1004|cDNA

GAGGTGGGGTAATTGGACATTAGACTTTCTATTTTAATAACGAATCCTCACTGCCTTCTGAGAGAAAGACCGCTCTTCTCCCTCTTTCTCTCTTATACCCACACTCATTCGCTCAAGAAATCGGGCTGGAAACGCAAACGGATCTGGTAAATCTTCGAAAGCAGTAATGGATTACTGCTTCAGATCTCTCTCTAGACTATCAATTTCCACGATTGTTCTCGCCATCTTGCTTTCTTCATTCAGTTTCACTTGCACAGAAG...

CDS

Download CDS FASTA

1461 bp · LXL04_013440|LXL04_013440|OH1004|CDS

ATGGATTACTGCTTCAGATCTCTCTCTAGACTATCAATTTCCACGATTGTTCTCGCCATCTTGCTTTCTTCATTCAGTTTCACTTGCACAGAAGCCTACGATGCACTCGACCCAAACGGAAACATCACAATCAAATGGGATATCATAAGTTGGACACCCGATGGCTACGTCGCCGTCGTTACAATGTACAACTTCCAACAATACCGCCACATTTCACCTCCAGGGTGGACATTAGGGTGGACATGGGCTAAAAAGGAAGT...

Protein

Download Protein FASTA

486 aa · LXL04_013440|LXL04_013440|OH1004|PROTEIN

MDYCFRSLSRLSISTIVLAILLSSFSFTCTEAYDALDPNGNITIKWDIISWTPDGYVAVVTMYNFQQYRHISPPGWTLGWTWAKKEVIWSMMGSQTTEQGDCSRYKSAPPHCCKKTPTVVDLLPGTPYNQQIANCCKGGVINSWAQDPNNYASSFQVSVGAAGTTNKTVKPPKNFTLLAPGPGYTCGPAVVGKPTKFITTDGRRVTQAMMTWNVTCTYSQFLAQKTPTCCVSLSSFYNDTIVPCPTCTCGCQNNITHPGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013440`
TK1151 ID	TkA02G496010
OH-1004 ID	LXL04_013440
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 98.664 / OH-1004 91.152 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013440

Location Chr03:29704588-29707309 (+)

Description Similar to COB: Protein COBRA

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g60920`	Involved in determining the orientation of cell expansion, probably by playing an important role in cellulose deposition.	No verified direct reference in this release
`At3g02210`	COBRA-like protein 1.	No verified direct reference in this release
`At3g29810`	COBRA-like protein 2.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0386800`	Involved in determining the orientation of cell expansion, probably by playing an important role in cellulose deposition.	No verified direct reference in this release
`Os07g0604300`	Involved in determining the orientation of cell expansion, probably by playing an important role in cellulose deposition.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013440 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009651 response to salt stress Biological Process

GO:0009664 plant-type cell wall organization Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0010214 seed coat development Biological Process

GO:0010215 cellulose microfibril organization Biological Process

GO:0048316 seed development Biological Process

GO:0048354 mucilage biosynthetic process involved in seed coat development Biological Process

GO:0052324 plant-type cell wall cellulose biosynthetic process Biological Process

GO:0005794 Golgi apparatus Cellular Component

GO:0005797 Golgi medial cisterna Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT3G02210

ath:AT3G29810

ath:AT5G60920

dosa:Os05g0386800

dosa:Os07g0604300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.792

Rank 1 · LXL04_013440 · OH-1004

Cytoplasm0.094

Rank 2 · LXL04_013440 · OH-1004

Extracellular0.071

Rank 3 · LXL04_013440 · OH-1004

Endoplasmic reticulum0.070

Rank 4 · LXL04_013440 · OH-1004

Lysosome / Vacuole0.063

Rank 5 · LXL04_013440 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04833.21COBRA_N56-219 aa

PF25079.2COB_C228-421 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013440	`PF04833.21`	COBRA_N	56	219	5.8e-68	228.8
LXL04_013440	`PF25079.2`	COB_C	228	421	2.8e-60	204.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94KT8`	Arabidopsis thaliana	Protein COBRA	78.190%	Swiss-Prot	strong database homology
`Q9SRT7`	Arabidopsis thaliana	COBRA-like protein 1	73.767%	Swiss-Prot	strong database homology
`Q8L8Q7`	Arabidopsis thaliana	COBRA-like protein 2	70.045%	Swiss-Prot	strong database homology
`Q60E70`	Oryza sativa subsp. japonica	COBRA-like protein 3	77.830%	Swiss-Prot	strong database homology
`Q6Z4G8`	Oryza sativa subsp. japonica	COBRA-like protein 1	72.584%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card