LXL04_013258 | RubberDandelionOmics

Gene overview

LXL04_013258

Reference: OH-1004 Chr: Chr03 Coordinates: 26637826-26641045 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2520 bp · LXL04_013258|LXL04_013258|OH1004|cDNA

ATGGACCAATCACTAGCCAGTTACACCAACAAGGTCTCACCATCATCTAACCCCGACAAACGACTCTTAACTACCACCAACCCCTTAACCAACACCACCTCACCTATGAACCCACTGATGCAACAACAGCCACATCAgcaacaccaacaacaacagCTCATGAGTCCTCTGGGACCCATGACTAACCCGGTTGCTCAACAGATGCTAGGTCTGTCGAGCAACCCGTTGCAACAGCAACTGATGGGGCCCAAAAACAACCC...

CDS

Download CDS FASTA

2520 bp · LXL04_013258|LXL04_013258|OH1004|CDS

ATGGACCAATCACTAGCCAGTTACACCAACAAGGTCTCACCATCATCTAACCCCGACAAACGACTCTTAACTACCACCAACCCCTTAACCAACACCACCTCACCTATGAACCCACTGATGCAACAACAGCCACATCAGCAACACCAACAACAACAGCTCATGAGTCCTCTGGGACCCATGACTAACCCGGTTGCTCAACAGATGCTAGGTCTGTCGAGCAACCCGTTGCAACAGCAACTGATGGGGCCCAAAAACAACCC...

Protein

Download Protein FASTA

839 aa · LXL04_013258|LXL04_013258|OH1004|PROTEIN

MDQSLASYTNKVSPSSNPDKRLLTTTNPLTNTTSPMNPLMQQQPHQQHQQQQLMSPLGPMTNPVAQQMLGLSSNPLQQQLMGPKNNPPMSSMMNPMMNPLMNPVHTNTPLHHPMATPVHNPMMQHQNRDERNSIFSASDDNVIMKQVLDTHLPDGTDVDVKPLLHIVEDILRHATIHADSSAEHTDVGKLEGKMESKLELAGKSHQTNAVVMLNSLSHIIDKLACEMSFRCLSGGDGHTTALALFHTVGNFHWDAKLVLT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013258`
TK1151 ID	TkA02G509010
OH-1004 ID	LXL04_013258
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013258

Location Chr03:26637826-26641045 (-)

Description Similar to SEOB: Protein SIEVE ELEMENT OCCLUSION B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01680`	Scaffold protein required to form the phloem filament matrix in sieve elements.	Arabidopsis P-protein filament formation requires both AtSEOR1 and AtSEOR2.2012 · DOI: 10.1093/pcp/pcs046
`At3g01670`	Scaffold protein required to form the phloem filament matrix in sieve elements.	Arabidopsis P-protein filament formation requires both AtSEOR1 and AtSEOR2.2012 · DOI: 10.1093/pcp/pcs046
`At1g67790`	Protein SIEVE ELEMENT OCCLUSION C.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0794400`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013258 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010088 phloem development Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0097218 sieve plate Cellular Component

GO:0042803 protein homodimerization activity Molecular Function

GO:0047134 protein-disulfide reductase [NAD(P)H] activity Molecular Function

KEGG gene cross-reference

ath:AT1G67790

ath:AT3G01670

ath:AT3G01680

dosa:Os01g0794400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.456

Rank 1 · LXL04_013258 · OH-1004

Cytoplasm0.353

Rank 2 · LXL04_013258 · OH-1004

Nucleus0.233

Rank 3 · LXL04_013258 · OH-1004

Endoplasmic reticulum0.090

Rank 4 · LXL04_013258 · OH-1004

Lysosome / Vacuole0.090

Rank 5 · LXL04_013258 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14576.12SEO_N138-434 aa

PF14577.12SEO_C600-830 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013258	`PF14576.12`	SEO_N	138	434	1.1e-104	350.4
LXL04_013258	`PF14577.12`	SEO_C	600	830	2.1e-99	332.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SS87`	Arabidopsis thaliana	Protein SIEVE ELEMENT OCCLUSION B	47.814%	Swiss-Prot	moderate database homology
`Q93XX2`	Arabidopsis thaliana	Protein SIEVE ELEMENT OCCLUSION A	35.310%	Swiss-Prot	moderate database homology
`Q9FXE2`	Arabidopsis thaliana	Protein SIEVE ELEMENT OCCLUSION C	26.761%	Swiss-Prot	weak database homology
`Q0JIL1`	Oryza sativa subsp. japonica	Probable nucleoredoxin 2	34.940%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card