LXL04_013133 | RubberDandelionOmics

Gene overview

LXL04_013133

Reference: OH-1004 Chr: Chr03 Coordinates: 24594131-24605139 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4350 bp · LXL04_013133|LXL04_013133|OH1004|cDNA

ATGGAATGTCAAAGGGTCATGTTGGCTCATGATGCCATAGGAAGTGTTAGAATGAATGCTATTAGATGGATTCTTGATGGATTTTCATTGAAGGCTGGAGATATGTTTGTTTTACTTTCTGTTCTTCATCACATCCACCATCCTATGGGTTACAAAATTCGAGTAGATGGTTCGATGTTTGGAGGAGCAAACCAAAAGGCTATCGATGATGAAGTTGCTAGGAAGAAGATCGAGTATGCGAACAATTTGGAACTTGTTCA...

CDS

Download CDS FASTA

4350 bp · LXL04_013133|LXL04_013133|OH1004|CDS

ATGGAATGTCAAAGGGTCATGTTGGCTCATGATGCCATAGGAAGTGTTAGAATGAATGCTATTAGATGGATTCTTGATGGATTTTCATTGAAGGCTGGAGATATGTTTGTTTTACTTTCTGTTCTTCATCACATCCACCATCCTATGGGTTACAAAATTCGAGTAGATGGTTCGATGTTTGGAGGAGCAAACCAAAAGGCTATCGATGATGAAGTTGCTAGGAAGAAGATCGAGTATGCGAACAATTTGGAACTTGTTCA...

Protein

Download Protein FASTA

1449 aa · LXL04_013133|LXL04_013133|OH1004|PROTEIN

MECQRVMLAHDAIGSVRMNAIRWILDGFSLKAGDMFVLLSVLHHIHHPMGYKIRVDGSMFGGANQKAIDDEVARKKIEYANNLELVQVSKLYEMQKITFKIEIVAGPIPKNAVVEESKKIDATWVILDRRTKRDRKYFLEKLSCGVSRMKRNDDIVKVRGPKPPKTQSPRAPLSYGDMLPVDHKVSTREAQNDEDLFSIEFDSSHGSSTSTRTSTSESMPSIGNNQDDKIQLSTLLEAFGEERESSPEKTNANIVESPTT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013133`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013133

Location Chr03:24594131-24605139 (-)

Description Similar to TIC100: Protein TIC 100

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22640`	Involved in protein precursor import into chloroplasts.	EMB1211 is required for normal embryo development and influences chloroplast biogenesis in Arabidopsis.2010 · DOI: 10.1111/j.1399-3054.2010.01407.x
`At1g70460`	Negatively regulates root hair elongation.	No verified direct reference in this release
`At5g38560`	Could be involved in the negative regulation of root growth.	PERK-KIPK-KCBP signalling negatively regulates root growth in Arabidopsis thaliana.2015 · DOI: 10.1093/jxb/eru390
`At1g26150`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release
`At1g23540`	Regulates the auxin-related MAX (More Axillary Growth) pathway during the shoot branching.	Over-expression of the IGI1 leading to altered shoot-branching development related to MAX pathway in Arabidopsis.2010 · DOI: 10.1007/s11103-010-9645-0

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013133 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0007165 signal transduction Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0032502 developmental process Biological Process

GO:0045037 protein import into chloroplast stroma Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

KEGG gene cross-reference

ath:AT1G23540

ath:AT1G26150

ath:AT1G70460

ath:AT5G22640

ath:AT5G38560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.414

Rank 1 · LXL04_013133 · OH-1004

Cytoplasm0.360

Rank 2 · LXL04_013133 · OH-1004

Nucleus0.297

Rank 3 · LXL04_013133 · OH-1004

Endoplasmic reticulum0.064

Rank 4 · LXL04_013133 · OH-1004

Golgi apparatus0.053

Rank 5 · LXL04_013133 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714.24PK_Tyr_Ser-Thr307-553 aa

PF00069.32Pkinase323-553 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013133	`PF07714.24`	PK_Tyr_Ser-Thr	307	553	3.1e-33	115.9
LXL04_013133	`PF00069.32`	Pkinase	323	553	2.5e-32	113.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPR8`	Arabidopsis thaliana	Protein TIC 100	66.047%	Swiss-Prot	weak database homology
`Q9CAL8`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK13	37.580%	Swiss-Prot	weak database homology
`Q9FFW5`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK8	37.458%	Swiss-Prot	weak database homology
`Q9C660`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK10	36.859%	Swiss-Prot	weak database homology
`Q9ZUE0`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK12	36.909%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card