LXL04_013071 | RubberDandelionOmics

Gene overview

LXL04_013071

Reference: OH-1004 Chr: Chr03 Coordinates: 23570711-23572368 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

948 bp · LXL04_013071|LXL04_013071|OH1004|cDNA

ATGTTTACATACGGTCAAGATCCCGATGTGGTTCGGTGGGGTCTCCAGCTGTTTGATGGTGGGCCATACACAGACAACTCCTATTGTGGATACGGTCCACAAAGTTACACAGATTGTTATCATGATCAGTATTCTAGAGAAGAAGCCAGTTATCACACGGAATGCATCAATACAGAAAATGACAAAAACCCTTTACTTTCTCCTCAAGAAAACACATCCCCATTTTTGGTTGCAGAAGTTTCATCACCTTCTTGTGAAGC...

CDS

Download CDS FASTA

948 bp · LXL04_013071|LXL04_013071|OH1004|CDS

ATGTTTACATACGGTCAAGATCCCGATGTGGTTCGGTGGGGTCTCCAGCTGTTTGATGGTGGGCCATACACAGACAACTCCTATTGTGGATACGGTCCACAAAGTTACACAGATTGTTATCATGATCAGTATTCTAGAGAAGAAGCCAGTTATCACACGGAATGCATCAATACAGAAAATGACAAAAACCCTTTACTTTCTCCTCAAGAAAACACATCCCCATTTTTGGTTGCAGAAGTTTCATCACCTTCTTGTGAAGC...

Protein

Download Protein FASTA

315 aa · LXL04_013071|LXL04_013071|OH1004|PROTEIN

MFTYGQDPDVVRWGLQLFDGGPYTDNSYCGYGPQSYTDCYHDQYSREEASYHTECINTENDKNPLLSPQENTSPFLVAEVSSPSCEAIDHSQSSFYLQDSLNQSMANYSLDDDENTNDSSTRQFDYGEELSYSLELSDDEVGKRLNQLASVPHVPKVNGEIPSLDEATLDHQRLLDRLQLYQLVESKVQGDGNCQFRALSDQVYRTTEHHQFVRQQIVNQLKLHADIYEGYVPMAYDDYLKNMAKVGEWGDHVTLQAAAD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013071`
TK1151 ID	TkA02G518700
OH-1004 ID	LXL04_013071
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 68.889 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013071

Location Chr03:23570711-23572368 (+)

Description Similar to OTU9: OVARIAN TUMOR DOMAIN-containing deubiquitinating enzyme 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g04250`	Hydrolase that can remove conjugated ubiquitin from proteins in vitro and may therefore play an important regulatory role at the level of protein turnover by preventing degradation (Probable).	No verified direct reference in this release
`At5g03330`	Hydrolase that can remove conjugated ubiquitin from proteins in vitro and may therefore play an important regulatory role at the level of protein turnover by preventing degradation (Probable).	No verified direct reference in this release
`At3g02070`	Hydrolase that can remove conjugated ubiquitin from proteins in vitro and may therefore play an important regulatory role at the level of protein turnover by preventing degradation (Probable).	No verified direct reference in this release
`At3g22260`	Hydrolase that can remove conjugated ubiquitin from proteins in vitro and may therefore play an important regulatory role at the level of protein turnover by preventing degradation (Probable).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013071 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004843 cysteine-type deubiquitinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G02070

ath:AT3G22260

ath:AT5G03330

ath:AT5G04250

ddi:DDB_G0284757

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.590

Rank 1 · LXL04_013071 · OH-1004

Nucleus0.465

Rank 2 · LXL04_013071 · OH-1004

Cell membrane0.077

Rank 3 · LXL04_013071 · OH-1004

Golgi apparatus0.062

Rank 4 · LXL04_013071 · OH-1004

Endoplasmic reticulum0.060

Rank 5 · LXL04_013071 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02338.26OTU189-275 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013071	`PF02338.26`	OTU	189	275	6.6e-12	46.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LBW2`	Arabidopsis thaliana	OVARIAN TUMOR DOMAIN-containing deubiquitinating enzyme 9	47.230%	Swiss-Prot	moderate database homology
`Q9LZF7`	Arabidopsis thaliana	OVARIAN TUMOR DOMAIN-containing deubiquitinating enzyme 10	62.130%	Swiss-Prot	moderate database homology
`Q9SGA5`	Arabidopsis thaliana	OVARIAN TUMOR DOMAIN-containing deubiquitinating enzyme 12	55.051%	Swiss-Prot	moderate database homology
`Q0V869`	Arabidopsis thaliana	OVARIAN TUMOR DOMAIN-containing deubiquitinating enzyme 11	52.486%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card