LXL04_013063 | RubberDandelionOmics

Gene overview

LXL04_013063

Reference: OH-1004 Chr: Chr03 Coordinates: 23413678-23417125 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2136 bp · LXL04_013063|LXL04_013063|OH1004|cDNA

atggGAGGCGAAAGCAAATGGACCAAGGTCAAGCTCGCTCTCGGCCTAAATACATGCCTTTACGTACCCAAAACCACCGACGACGATGAATCACCGCCGTCACCGTCTTCACGCTCTCGTAAGAGTTCAGAAATTCGTCACCGAATGCCCACGACTCCGACTCCTTCGTCCTCCGGCCTTCAGCTGTCAAAATACGGCATTAAATCGTCGTCCAAGAGGATTTGTGCAATATGTTTAACCACAATCAAAACAACAAACGG...

CDS

Download CDS FASTA

2136 bp · LXL04_013063|LXL04_013063|OH1004|CDS

ATGGGAGGCGAAAGCAAATGGACCAAGGTCAAGCTCGCTCTCGGCCTAAATACATGCCTTTACGTACCCAAAACCACCGACGACGATGAATCACCGCCGTCACCGTCTTCACGCTCTCGTAAGAGTTCAGAAATTCGTCACCGAATGCCCACGACTCCGACTCCTTCGTCCTCCGGCCTTCAGCTGTCAAAATACGGCATTAAATCGTCGTCCAAGAGGATTTGTGCAATATGTTTAACCACAATCAAAACAACAAACGG...

Protein

Download Protein FASTA

711 aa · LXL04_013063|LXL04_013063|OH1004|PROTEIN

MGGESKWTKVKLALGLNTCLYVPKTTDDDESPPSPSSRSRKSSEIRHRMPTTPTPSSSGLQLSKYGIKSSSKRICAICLTTIKTTNGHALFTAECSHSFHFNCITSNVKHGNRVCPVCRARWKQIPFENSGSSRVKSNTNSNSNSGSWSHNDSYMILPPSNQNVPFLFQPPEPPVFDDDEPLNQTPEETFSNSDSDHSLEIKTYPEISAVAKSTRFDNFGILINLKAPVTKGNTNSRAPIDLVTVLDISGSMTGTKIALL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013063`
TK1151 ID	TkA02G519290
OH-1004 ID	LXL04_013063
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	95.700
Protein coverage (%)	TK1151 92.481 / OH-1004 69.198 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013063

Location Chr03:23413678-23417125 (-)

Description Similar to WAV3: E3 ubiquitin-protein ligase WAV3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g49665`	E3 ubiquitin-protein ligase involved in the regulation of root growth.	The wavy growth 3 E3 ligase family controls the gravitropic response in Arabidopsis roots.2012 · DOI: 10.1111/j.1365-313x.2011.04870.x
`At2g22680`	E3 ubiquitin-protein ligase involved in the regulation of root growth.	The wavy growth 3 E3 ligase family controls the gravitropic response in Arabidopsis roots.2012 · DOI: 10.1111/j.1365-313x.2011.04870.x
`At5g65683`	Probable E3 ubiquitin-protein ligase involved in the regulation of root growth.	The wavy growth 3 E3 ligase family controls the gravitropic response in Arabidopsis roots.2012 · DOI: 10.1111/j.1365-313x.2011.04870.x
`At4g37890`	Probable E3 ubiquitin-protein ligase involved in female gametophyte development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013063 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009630 gravitropism Biological Process

GO:0010197 polar nucleus fusion Biological Process

GO:0010274 hydrotropism Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0048364 root development Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT2G22680

ath:AT4G37890

ath:AT5G49665

ath:AT5G65683

syn:sll0103

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.419

Rank 1 · LXL04_013063 · OH-1004

Cytoplasm0.400

Rank 2 · LXL04_013063 · OH-1004

Cell membrane0.223

Rank 3 · LXL04_013063 · OH-1004

Endoplasmic reticulum0.063

Rank 4 · LXL04_013063 · OH-1004

Lysosome / Vacuole0.049

Rank 5 · LXL04_013063 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14569.13zf-UDP68-140 aa

PF00097.32zf-C3HC475-118 aa

PF17123.12zf-RING_1175-104 aa

PF13639.13zf-RING_275-119 aa

PF12678.14zf-rbx175-119 aa

PF05762.21VWA_CoxE236-351 aa

PF00092.35VWA241-425 aa

PF13768.13VWA_3241-414 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013063	`PF14569.13`	zf-UDP	68	140	2e-07	31.7
LXL04_013063	`PF00097.32`	zf-C3HC4	75	118	8.4e-09	35.9
LXL04_013063	`PF17123.12`	zf-RING_11	75	104	1.8e-08	34.6
LXL04_013063	`PF13639.13`	zf-RING_2	75	119	4.9e-07	30.6
LXL04_013063	`PF12678.14`	zf-rbx1	75	119	5.6e-06	27.2
LXL04_013063	`PF05762.21`	VWA_CoxE	236	351	5.8e-09	36.4
LXL04_013063	`PF00092.35`	VWA	241	425	3.5e-20	73.7
LXL04_013063	`PF13768.13`	VWA_3	241	414	4.3e-16	60.1
LXL04_013063	`PF13519.13`	VWA_2	242	348	1.2e-17	65.1
LXL04_013063	`PF14624.12`	Vwaint	602	674	9.8e-20	71.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LTA6`	Arabidopsis thaliana	E3 ubiquitin-protein ligase WAV3	29.129%	Swiss-Prot	weak database homology
`Q9ZQ46`	Arabidopsis thaliana	E3 ubiquitin-protein ligase WAVH1	29.693%	Swiss-Prot	weak database homology
`Q0WQX9`	Arabidopsis thaliana	Probable E3 ubiquitin-protein ligase WAVH2	29.585%	Swiss-Prot	weak database homology
`F4JSV3`	Arabidopsis thaliana	Probable E3 ubiquitin-protein ligase EDA40	28.450%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card