Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1305 bp · LXL04_013015|LXL04_013015|OH1004|cDNA
ATGAGTATTGCATCGAAATCGATACGATGTTTCAAGCAAATCTGTGCCCATCTAAAAGTTCCCCAAAGCCCTAATTATTCAAGCACCAGATACATATTAATTCTGGATACAATGAGTATTGCATCGAAATCGATACGATGTTTCAAGCAAATCTGTGCCCATCTAAAAGTTCCCCAAAGCCCTAATTATTCAAGCACCAGATACATATTAGTTTCCCTCTTTTCATCGACATCATACAGGCAGCGACTCAACAGAAGAAT...
1305 bp · LXL04_013015|LXL04_013015|OH1004|CDS
ATGAGTATTGCATCGAAATCGATACGATGTTTCAAGCAAATCTGTGCCCATCTAAAAGTTCCCCAAAGCCCTAATTATTCAAGCACCAGATACATATTAATTCTGGATACAATGAGTATTGCATCGAAATCGATACGATGTTTCAAGCAAATCTGTGCCCATCTAAAAGTTCCCCAAAGCCCTAATTATTCAAGCACCAGATACATATTAGTTTCCCTCTTTTCATCGACATCATACAGGCAGCGACTCAACAGAAGAAT...
Protein
Download Protein FASTA434 aa · LXL04_013015|LXL04_013015|OH1004|PROTEIN
MSIASKSIRCFKQICAHLKVPQSPNYSSTRYILILDTMSIASKSIRCFKQICAHLKVPQSPNYSSTRYILVSLFSSTSYRQRLNRRILAASKPTLDEPRFRRAVSQLLPRFKPEELHNLINLQEDPLVCLELFNWASQQPRFTHDVSTFHVTIKKLGAAKMYDEMDIIANEVLAIPSFGSEGLFNTMIYFYTEARKLSRAVNVYKHMRSLKKLDCKPSIRTYNLLFTSFLSRRSNTYINHMYMGTMSMLFKQMIEDGINP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_013015 |
|---|---|
| TK1151 ID | TkA02G522560 |
| OH-1004 ID | LXL04_013015 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 86.300 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 62.442Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_013015 | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:22357553-22359092 (-) | ||||||||||||||||||
| Description | Similar to At2g27800: Pentatricopeptide repeat-containing protein At2g27800, mitochondrial | ||||||||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | ||||||||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||||||||
| GO annotations (OH1004 source) | GO:0000373 Group II intron splicing Biological Process GO:0000963 mitochondrial RNA processing Biological Process GO:0006397 mRNA processing Biological Process GO:0032981 mitochondrial respiratory chain complex I assembly Biological Process GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005829 cytosol Cellular Component GO:0003729 mRNA binding Molecular Function | ||||||||||||||||||
| KEGG gene cross-reference | ath:AT2G17525 ath:AT2G27800 ath:AT3G25210 ath:AT4G01400 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13041.13PPR_2184-229 aaPF17177.11PPR_long196-360 aaPF13041.13PPR_2260-309 aaPF12854.14PPR_1293-325 aaPF13041.13PPR_2296-344 aaPF13812.13PPR_3296-343 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_013015 | PF13041.13 | PPR_2 | 184 | 229 | 5.9e-32 | 110.2 |
| LXL04_013015 | PF17177.11 | PPR_long | 196 | 360 | 2.5e-06 | 27.7 |
| LXL04_013015 | PF13041.13 | PPR_2 | 260 | 309 | 5.9e-32 | 110.2 |
| LXL04_013015 | PF12854.14 | PPR_1 | 293 | 325 | 1.9e-23 | 82.6 |
| LXL04_013015 | PF13041.13 | PPR_2 | 296 | 344 | 5.9e-32 | 110.2 |
| LXL04_013015 | PF13812.13 | PPR_3 | 296 | 343 | 1.5e-14 | 54.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
Q9ZUY1 | Arabidopsis thaliana | Pentatricopeptide repeat-containing protein At2g27800, mitochondrial | 58.824% | Swiss-Prot | strong database homology |
Q9LSF5 | Arabidopsis thaliana | Pentatricopeptide repeat-containing protein At3g25210, mitochondrial | 32.680% | Swiss-Prot | moderate database homology |
Q8LDU5 | Arabidopsis thaliana | Pentatricopeptide repeat-containing protein At4g01400, mitochondrial | 26.648% | Swiss-Prot | weak database homology |
Q84VG6 | Arabidopsis thaliana | Pentatricopeptide repeat-containing protein At2g17525, mitochondrial | 24.399% | Swiss-Prot | weak database homology |
Q9FFE3 | Arabidopsis thaliana | Pentatricopeptide repeat-containing protein At5g16420, mitochondrial | 24.161% | Swiss-Prot | weak database homology |