LXL04_013013 | RubberDandelionOmics

Gene overview

LXL04_013013

Reference: OH-1004 Chr: Chr03 Coordinates: 22250526-22255186 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1980 bp · LXL04_013013|LXL04_013013|OH1004|cDNA

ATGCCAGGCTCAGCGTCGACGACTCACCGTCCTGAGGGTTTAATTGATCGGCTTCGCTCCGCCGCTGCAGACGGCGGAGAAGCCAAATTTAAGGTCCTCAGGGAACTCAAGAACCAGATAATTGGCAATCGCACGAAGAAGCTGTCGTACATCAAGCTAGGCGCCGTCCCTTCCGTCGTATCGATTCTCTCATCCGCTTCCTCTTCAGTCGATTGCCTCCTCATCCAGTGTGCCGCAACCATAGGCAGTTTTGCGTGCGG...

CDS

Download CDS FASTA

1980 bp · LXL04_013013|LXL04_013013|OH1004|CDS

ATGCCAGGCTCAGCGTCGACGACTCACCGTCCTGAGGGTTTAATTGATCGGCTTCGCTCCGCCGCTGCAGACGGCGGAGAAGCCAAATTTAAGGTCCTCAGGGAACTCAAGAACCAGATAATTGGCAATCGCACGAAGAAGCTGTCGTACATCAAGCTAGGCGCCGTCCCTTCCGTCGTATCGATTCTCTCATCCGCTTCCTCTTCAGTCGATTGCCTCCTCATCCAGTGTGCCGCAACCATAGGCAGTTTTGCGTGCGG...

Protein

Download Protein FASTA

659 aa · LXL04_013013|LXL04_013013|OH1004|PROTEIN

MPGSASTTHRPEGLIDRLRSAAADGGEAKFKVLRELKNQIIGNRTKKLSYIKLGAVPSVVSILSSASSSVDCLLIQCAATIGSFACGVDAGVKAVLDAGAFPHLINLLSHSNEKVVDAGARALKMIYQSPSAPKYDFTQPKNIEFLTSLLDKTNENVTGLGATIITHSCQTPTEQTLLSNAGVLKKLIHLLHATSPQRDASLESFATIIKQNPHVITNHVGPQNGSTFRTLLDLTKDRYPRTRLLACVCLTLIKNATSSA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013013`
TK1151 ID	TkA02G523100
OH-1004 ID	LXL04_013013
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_013013`
Location	Chr03:22250526-22255186 (+)
Description	Similar to ARMC8: Armadillo repeat-containing protein 8
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_013013` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process GO:0000151 ubiquitin ligase complex Cellular Component GO:0005576 extracellular region Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0034657 GID complex Cellular Component GO:1904724 tertiary granule lumen Cellular Component
KEGG gene cross-reference	bta:539591 dre:571528 hsa:25852 mmu:74125 pon:100173472 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.604

Rank 1 · LXL04_013013 · OH-1004

Nucleus0.400

Rank 2 · LXL04_013013 · OH-1004

Cell membrane0.058

Rank 3 · LXL04_013013 · OH-1004

Mitochondrion0.054

Rank 4 · LXL04_013013 · OH-1004

Golgi apparatus0.046

Rank 5 · LXL04_013013 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24768.2ARM_ARMC552-198 aa

PF25598.2ARM_PUB81-324 aa

PF00514.30Arm92-116 aa

PF25598.2ARM_PUB340-457 aa

PF00514.30Arm435-469 aa

PF30130.1VID28_C449-511 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013013	`PF24768.2`	ARM_ARMC5	52	198	1.4e-10	41.7
LXL04_013013	`PF25598.2`	ARM_PUB	81	324	6.9e-14	52.7
LXL04_013013	`PF00514.30`	Arm	92	116	2.7e-24	85.1
LXL04_013013	`PF25598.2`	ARM_PUB	340	457	6.9e-14	52.7
LXL04_013013	`PF00514.30`	Arm	435	469	2.7e-24	85.1
LXL04_013013	`PF30130.1`	VID28_C	449	511	8.6e-06	25.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card