LXL04_012937 | RubberDandelionOmics

Gene overview

LXL04_012937

Reference: OH-1004 Chr: Chr03 Coordinates: 21286653-21289711 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2133 bp · LXL04_012937|LXL04_012937|OH1004|cDNA

ATGGCTCAATCTTTCTACACCAGTCTTTCAAAATCAACCACCATTTTCGCCTCTTCAACCTCCCCTTCATGCACCCTCGTCTTCATCCTCACCCTCTGCATTATCTCTCTCTACACACTTCACCTCCATAACCACGAAACACCTCCTCCGTCACCATCCACCACCGCCCAACGCCCACCACTCATCTCCACTTTCCTTAACTCTGCCTCTAATTACACTATCTCTAACTATCTCCGCCACCTTACTCTCCACCCCCATCT...

CDS

Download CDS FASTA

2133 bp · LXL04_012937|LXL04_012937|OH1004|CDS

ATGGCTCAATCTTTCTACACCAGTCTTTCAAAATCAACCACCATTTTCGCCTCTTCAACCTCCCCTTCATGCACCCTCGTCTTCATCCTCACCCTCTGCATTATCTCTCTCTACACACTTCACCTCCATAACCACGAAACACCTCCTCCGTCACCATCCACCACCGCCCAACGCCCACCACTCATCTCCACTTTCCTTAACTCTGCCTCTAATTACACTATCTCTAACTATCTCCGCCACCTTACTCTCCACCCCCATCT...

Protein

Download Protein FASTA

710 aa · LXL04_012937|LXL04_012937|OH1004|PROTEIN

MAQSFYTSLSKSTTIFASSTSPSCTLVFILTLCIISLYTLHLHNHETPPPSPSTTAQRPPLISTFLNSASNYTISNYLRHLTLHPHLAGTPPSSASADYVKSNFESLHLQTHVTNYSVLLSYHLHSSLTGHFSNRSTAVTLPLTEPGLGSDSGVVKPYHAYSPSGSAYGKAVYIHHGREEDYRALASAGVDVRGCVAVAKRGGGMSRNAVVVKAAEKGVAAVLMYTVNNDRARTDHGGGVERGTVLDGVGDPQTPGWAAT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012937`
TK1151 ID	TkA02G527740
OH-1004 ID	LXL04_012937
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.700
Protein coverage (%)	TK1151 99.711 / OH-1004 96.761 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012937

Location Chr03:21286653-21289711 (-)

Description Similar to AMP1: Probable glutamate carboxypeptidase AMP1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g54720`	May modulate the level of one or more small signaling molecules that have a role in regulating meristem function.	A comparative analysis of the Arabidopsis mutant amp1-1 and a novel weak amp1 allele reveals new functions of the AMP1 protein.2007 · DOI: 10.1007/s00425-006-0395-9 AMP1 and MP antagonistically regulate embryo and meristem development in Arabidopsis.2007 · DOI: 10.1242/dev.006759 ALTERED MERISTEM PROGRAM 1 is involved in development of seed dormancy in Arabidopsis.2011 · DOI: 10.1371/journal.pone.0020408 Arabidopsis ALTERED MERISTEM PROGRAM 1 negatively modulates plant responses to abscisic acid and dehydration stress.2013 · DOI: 10.1016/j.plaphy.2013.03.016 The glutamate carboxypeptidase AMP1 mediates abscisic acid and abiotic stress responses in Arabidopsis.2013 · DOI: 10.1111/nph.12275 ALTERED MERISTEM PROGRAM1 has conflicting effects on the tolerance to heat shock and symptom development after Pseudomonas syringae infection.2016 · DOI: 10.1016/j.bbrc.2016.10.025
`At5g19740`	Acts in association with AMP1 to suppress ectopic stem cell niche formation in the shoot apical meristem (SAM) independently of cytokinin signaling pathway.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0790600`	Involved in the regular timing (plastochron) of lateral organs formation.	PLASTOCHRON3/GOLIATH encodes a glutamate carboxypeptidase required for proper development in rice.2009 · DOI: 10.1111/j.1365-313x.2009.03841.x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012937 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009908 flower development Biological Process

GO:0010073 meristem maintenance Biological Process

GO:0010074 maintenance of meristem identity Biological Process

GO:0010075 regulation of meristem growth Biological Process

GO:0010080 regulation of floral meristem growth Biological Process

GO:0010081 regulation of inflorescence meristem growth Biological Process

GO:0010082 regulation of root meristem growth Biological Process

GO:0010305 leaf vascular tissue pattern formation Biological Process

GO:0048364 root development Biological Process

KEGG gene cross-reference

ath:AT3G54720

ath:AT5G19740

dosa:Os03g0790600

hsa:10003

zma:100147738

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.421

Rank 1 · LXL04_012937 · OH-1004

Endoplasmic reticulum0.276

Rank 2 · LXL04_012937 · OH-1004

Cytoplasm0.136

Rank 3 · LXL04_012937 · OH-1004

Extracellular0.124

Rank 4 · LXL04_012937 · OH-1004

Golgi apparatus0.089

Rank 5 · LXL04_012937 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04389.23Peptidase_M28341-528 aa

PF04253.21TFR_dimer587-706 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012937	`PF04389.23`	Peptidase_M28	341	528	2.4e-21	77.1
LXL04_012937	`PF04253.21`	TFR_dimer	587	706	2.3e-31	109.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M1S8`	Arabidopsis thaliana	Probable glutamate carboxypeptidase AMP1	55.971%	Swiss-Prot	strong database homology
`Q7Y228`	Arabidopsis thaliana	Probable glutamate carboxypeptidase LAMP1	44.228%	Swiss-Prot	moderate database homology
`Q852M4`	Oryza sativa subsp. japonica	Probable glutamate carboxypeptidase PLA3	52.672%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card