RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_012915
Reference: OH-1004 Chr: Chr03 Coordinates: 20796257-20801311 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2712 bp · LXL04_012915|LXL04_012915|OH1004|cDNA

ATGCTAGCAAGCAGTAGCTTTCATGGCCGACCTTATTCCCACTTCGTGCACACAACAAGTAATAGAGACAACAAATCCTCTATCTCCTACTTTCCAGTTGCAAAACCCCACTCTATTTCTTCTGTCTGCGGTTTACTTTTGTCCAGAAGAATAACCTCGAAGCGGTTCAAAATACGGGCTTTAAAACGTGAGTCTGATTTCGAGTCAGCTGCAGAAAAAGAAGCAGTACCTTTTTTTCCTCACCGACATTCCGTTAAAAT...

CDS

Download CDS FASTA

2712 bp · LXL04_012915|LXL04_012915|OH1004|CDS

ATGCTAGCAAGCAGTAGCTTTCATGGCCGACCTTATTCCCACTTCGTGCACACAACAAGTAATAGAGACAACAAATCCTCTATCTCCTACTTTCCAGTTGCAAAACCCCACTCTATTTCTTCTGTCTGCGGTTTACTTTTGTCCAGAAGAATAACCTCGAAGCGGTTCAAAATACGGGCTTTAAAACGTGAGTCTGATTTCGAGTCAGCTGCAGAAAAAGAAGCAGTACCTTTTTTTCCTCACCGACATTCCGTTAAAAT...

Protein

Download Protein FASTA

903 aa · LXL04_012915|LXL04_012915|OH1004|PROTEIN

MLASSSFHGRPYSHFVHTTSNRDNKSSISYFPVAKPHSISSVCGLLLSRRITSKRFKIRALKRESDFESAAEKEAVPFFPHRHSVKIPVGDRHIIVETGQIGRQASGSVIVRDGETILYTSVCLSDTPSEPSDFFPMSVNYQERFSAAGRTSGGFFKREGRTKDHEVLICRLIDRPIRPTMRKGFYHETQILSWVLSYDGLHPPDSLAVTAAGIAVALSEVPNTTTISGVRIGLIDDKFVVNPTTAEMEKSKLDLLLAGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_012915
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_012915
LocationChr03:20796257-20801311 (+)
DescriptionSimilar to PNP1: Probable polyribonucleotide nucleotidyltransferase 1, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g03710 Involved in the metabolism of all major classes of plastid RNAs.
Unexpected Diversity of Chloroplast Noncoding RNAs as Revealed by Deep Sequencing of the Arabidopsis Transcriptome.2011 · DOI: 10.1534/g3.111.000752

Rice

Reference gene IDPossible functionPapers / DOI
Os07g0168000 Involved in the metabolism of all major classes of plastid RNAs. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_012915 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000958 mitochondrial mRNA catabolic process Biological Process
GO:0000965 mitochondrial RNA 3'-end processing Biological Process
GO:0006364 rRNA processing Biological Process
GO:0006396 RNA processing Biological Process
GO:0006397 mRNA processing Biological Process
GO:0006401 RNA catabolic process Biological Process
GO:0006402 mRNA catabolic process Biological Process
GO:0008033 tRNA processing Biological Process
GO:0010323 negative regulation of isopentenyl diphosphate biosynthetic process, methylerythritol 4-phosphate pathway Biological Process
GO:0015995 chlorophyll biosynthetic process Biological Process
GO:0016036 cellular response to phosphate starvation Biological Process
GO:0016120 carotene biosynthetic process Biological Process
KEGG gene cross-reference
ath:AT3G03710
cab:CAB730
cca:CCA_00762
dosa:Os07g0168000
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.754
Rank 1 · LXL04_012915 · OH-1004
Mitochondrion0.316
Rank 2 · LXL04_012915 · OH-1004
Cytoplasm0.066
Rank 3 · LXL04_012915 · OH-1004
Nucleus0.040
Rank 4 · LXL04_012915 · OH-1004
Peroxisome0.025
Rank 5 · LXL04_012915 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01138.28RNase_PH92-222 aa
PF03725.21RNase_PH_C227-289 aa
PF01138.28RNase_PH450-584 aa
PF00013.36KH_1691-747 aa
PF00575.30S1763-826 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_012915PF01138.28RNase_PH922226.4e-55185.8
LXL04_012915PF03725.21RNase_PH_C2272893.6e-2072.4
LXL04_012915PF01138.28RNase_PH4505846.4e-55185.8
LXL04_012915PF00013.36KH_16917474.7e-0627.0
LXL04_012915PF00575.30S17638261.9e-1351.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8GZQ3Arabidopsis thalianaPolyribonucleotide nucleotidyltransferase 1, chloroplastic68.627%Swiss-Protstrong database homology
Q69LE7Oryza sativa subsp. japonicaProbable polyribonucleotide nucleotidyltransferase 1, chloroplastic74.419%Swiss-Protstrong database homology

JBrowse

View in Genome Browser