LXL04_012908 | RubberDandelionOmics

Gene overview

LXL04_012908

Reference: OH-1004 Chr: Chr03 Coordinates: 20732026-20733879 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1203 bp · LXL04_012908|LXL04_012908|OH1004|cDNA

ATGAGTCATGAATTGACCGTGGCACCACCAGTACAGCCGGCGGCGCCACCACCATCATCGCCACCGCCGACGTCTCTTGCACCTGGATTTCGGTTTCACCCAACCGATGAGGAACTTGTGCGGTATTATCTGAGGCGTAAAGCTTGTGGGAAGCCGTTTCGATTCGAAGCTGTATCAGAAATCGACGTCTACAAATCCGAGCCATGGGAGCTTGCAGATTATTCATCCCTAAAGACGCGAGACCTCGAATGGTACTTCTT...

CDS

Download CDS FASTA

1203 bp · LXL04_012908|LXL04_012908|OH1004|CDS

ATGAGTCATGAATTGACCGTGGCACCACCAGTACAGCCGGCGGCGCCACCACCATCATCGCCACCGCCGACGTCTCTTGCACCTGGATTTCGGTTTCACCCAACCGATGAGGAACTTGTGCGGTATTATCTGAGGCGTAAAGCTTGTGGGAAGCCGTTTCGATTCGAAGCTGTATCAGAAATCGACGTCTACAAATCCGAGCCATGGGAGCTTGCAGATTATTCATCCCTAAAGACGCGAGACCTCGAATGGTACTTCTT...

Protein

Download Protein FASTA

400 aa · LXL04_012908|LXL04_012908|OH1004|PROTEIN

MSHELTVAPPVQPAAPPPSSPPPTSLAPGFRFHPTDEELVRYYLRRKACGKPFRFEAVSEIDVYKSEPWELADYSSLKTRDLEWYFFSPVDRKYGNGSRLNRATGRGYWKATGKDRSVRHKSETIGMKKTLVFHSGRAPDGKRTNWVMHEYRLVDQELVRAGVVQDAFVLCRIFQKSGLGPPNGDRYAPFIEEEWVDDDTAVFVPGGETEDDLTPGDETLPQGNDIVQENPGNMICSQSEAMVNHQTIPFVCKRERSDDS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012908`
TK1151 ID	TkA02G531140
OH-1004 ID	LXL04_012908
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012908

Location Chr03:20732026-20733879 (-)

Description Similar to NAC052: NAC domain containing protein 52

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g10490`	Transcriptional repressor that binds to the motif 5'- (C/T)A(C/A)G-3' in the promoter of target genes.	Two novel NAC transcription factors regulate gene expression and flowering time by associating with the histone demethylase JMJ14.2015 · DOI: 10.1093/nar/gku1382 C-terminal domains of a histone demethylase interact with a pair of transcription factors and mediate specific chromatin association.2015 · DOI: 10.1038/celldisc.2015.3
`At3g10480`	Transcriptional repressor that binds to the motif 5'- (C/T)A(C/A)G-3' in the promoter of target genes.	Two novel NAC transcription factors regulate gene expression and flowering time by associating with the histone demethylase JMJ14.2015 · DOI: 10.1093/nar/gku1382 C-terminal domains of a histone demethylase interact with a pair of transcription factors and mediate specific chromatin association.2015 · DOI: 10.1038/celldisc.2015.3
`At5g04410`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP) (By similarity).	No verified direct reference in this release
`At3g10500`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP).	A NAC transcription factor NTL4 promotes reactive oxygen species production during drought-induced leaf senescence in Arabidopsis.2012 · DOI: 10.1111/j.1365-313x.2012.04932.x The Arabidopsis NAC transcription factor NTL4 participates in a positive feedback loop that induces programmed cell death under heat stress conditions.2014 · DOI: 10.1016/j.plantsci.2014.07.003
`At1g34180`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP) (By similarity).	Mutation of the Arabidopsis NAC016 transcription factor delays leaf senescence.2013 · DOI: 10.1093/pcp/pct113

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012908 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009555 pollen development Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0009908 flower development Biological Process

GO:0009962 regulation of flavonoid biosynthetic process Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0010267 ta-siRNA processing Biological Process

GO:0016441 post-transcriptional gene silencing Biological Process

GO:0045814 negative regulation of gene expression, epigenetic Biological Process

KEGG gene cross-reference

ath:AT3G10480

ath:AT3G10490

ath:AT5G04410

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.955

Rank 1 · LXL04_012908 · OH-1004

Cytoplasm0.102

Rank 2 · LXL04_012908 · OH-1004

Cell membrane0.038

Rank 3 · LXL04_012908 · OH-1004

Endoplasmic reticulum0.028

Rank 4 · LXL04_012908 · OH-1004

Plastid0.015

Rank 5 · LXL04_012908 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365.21NAM28-153 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012908	`PF02365.21`	NAM	28	153	1.8e-47	161.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SQY0`	Arabidopsis thaliana	NAC domain containing protein 52	58.921%	Swiss-Prot	moderate database homology
`Q9SQX9`	Arabidopsis thaliana	NAC domain containing protein 50	57.724%	Swiss-Prot	moderate database homology
`Q84K00`	Arabidopsis thaliana	NAC domain-containing protein 78	69.022%	Swiss-Prot	weak database homology
`Q949N0`	Arabidopsis thaliana	NAC domain-containing protein 53	63.436%	Swiss-Prot	moderate database homology
`A4FVP6`	Arabidopsis thaliana	NAC domain-containing protein 16	41.212%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card