LXL04_012897 | RubberDandelionOmics

Gene overview

LXL04_012897

Reference: OH-1004 Chr: Chr03 Coordinates: 20601819-20605259 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2658 bp · LXL04_012897|LXL04_012897|OH1004|cDNA

ATGATATTTGATACAGAGACAGACGTGTCAATTCAATTCTTCCTCTGTGGCATAGAAATCGCTCGCGCCCAACGAACAACAATTGAAAAACTTTTACCATCTATCAACCAATTTCAACCCTCCGCCTCCCGCATTTTCTATGTGAAAtcaaacaacacacaaatcCATACACTTCATCGTTTTCGTTTTCAATCCGCCACAGCTTCATCTTCATCTGCTTTTTTTCTCTTTTGCTTTAACAACAACCGTGATTTCCTAGG...

CDS

Download CDS FASTA

2658 bp · LXL04_012897|LXL04_012897|OH1004|CDS

ATGATATTTGATACAGAGACAGACGTGTCAATTCAATTCTTCCTCTGTGGCATAGAAATCGCTCGCGCCCAACGAACAACAATTGAAAAACTTTTACCATCTATCAACCAATTTCAACCCTCCGCCTCCCGCATTTTCTATGTGAAATCAAACAACACACAAATCCATACACTTCATCGTTTTCGTTTTCAATCCGCCACAGCTTCATCTTCATCTGCTTTTTTTCTCTTTTGCTTTAACAACAACCGTGATTTCCTAGG...

Protein

Download Protein FASTA

885 aa · LXL04_012897|LXL04_012897|OH1004|PROTEIN

MIFDTETDVSIQFFLCGIEIARAQRTTIEKLLPSINQFQPSASRIFYVKSNNTQIHTLHRFRFQSATASSSSAFFLFCFNNNRDFLGFCIPQCVETGNAASEYHVPGCKVSEKMTDVQQQFPQKPETAATTTDACSDFEKRFEELMRGQLDDCMSFASCSSPRGEDDDETETGGDQLMRRRRRSDLEGDDLAESSAARRRHSRILSRWAARQAQEMIATTERRNRESELMALAGLHTVSMLDSSFLRESHSQSPSPTSRG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012897`
TK1151 ID	TkA02G531620
OH-1004 ID	LXL04_012897
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.200
Protein coverage (%)	TK1151 100.000 / OH-1004 87.232 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012897

Location Chr03:20601819-20605259 (+)

Description Similar to neur: Protein neuralized

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0446100`	Probable E3 ubiquitin-protein ligase XBOS34.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012897 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000209 protein polyubiquitination Biological Process

GO:0007219 Notch signaling pathway Biological Process

GO:0008104 intracellular protein localization Biological Process

GO:0008356 asymmetric cell division Biological Process

GO:0008593 regulation of Notch signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0030718 germ-line stem cell population maintenance Biological Process

GO:0045747 positive regulation of Notch signaling pathway Biological Process

GO:0045807 positive regulation of endocytosis Biological Process

GO:0070086 ubiquitin-dependent endocytosis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

dme:Dmel_CG11988

dosa:Os07g0446100

hsa:54492

mmu:240055

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.536

Rank 1 · LXL04_012897 · OH-1004

Nucleus0.457

Rank 2 · LXL04_012897 · OH-1004

Cell membrane0.116

Rank 3 · LXL04_012897 · OH-1004

Mitochondrion0.073

Rank 4 · LXL04_012897 · OH-1004

Endoplasmic reticulum0.060

Rank 5 · LXL04_012897 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13920.13zf-C3HC4_3830-877 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012897	`PF13920.13`	zf-C3HC4_3	830	877	1.1e-11	45.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7XI08`	Oryza sativa subsp. japonica	Probable E3 ubiquitin-protein ligase XBOS34	34.783%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card