Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1047 bp · LXL04_012878|LXL04_012878|OH1004|cDNA
ATGCCGAAAGGAGATGATTATATGATAAAGAAGAAGAACAAATCGACCAGGAAGAAATTGCGGAGCGAGTCATCGAAGGTCTCTAATCGCGTCGCCGCTATCATCGCACAAAAAAAGCGTCGTCAGTCCGGCAAACGCAGAATGTGTCAGGGAATGTGTTTTAGCCTCCCTACTCCTGAAGATCCTTTCTTAGACAAACCTCCAGCTCATGATTCCAAGAAAAAAGACAAGACAAAGAAGACTAAGAAAGATAAGCCATC...
1047 bp · LXL04_012878|LXL04_012878|OH1004|CDS
ATGCCGAAAGGAGATGATTATATGATAAAGAAGAAGAACAAATCGACCAGGAAGAAATTGCGGAGCGAGTCATCGAAGGTCTCTAATCGCGTCGCCGCTATCATCGCACAAAAAAAGCGTCGTCAGTCCGGCAAACGCAGAATGTGTCAGGGAATGTGTTTTAGCCTCCCTACTCCTGAAGATCCTTTCTTAGACAAACCTCCAGCTCATGATTCCAAGAAAAAAGACAAGACAAAGAAGACTAAGAAAGATAAGCCATC...
Protein
Download Protein FASTA348 aa · LXL04_012878|LXL04_012878|OH1004|PROTEIN
MPKGDDYMIKKKNKSTRKKLRSESSKVSNRVAAIIAQKKRRQSGKRRMCQGMCFSLPTPEDPFLDKPPAHDSKKKDKTKKTKKDKPSKGVDNLSENGTDPSQNKRKATDEPQSNGKNQVHKRPKAEKDEGCPSKFLISCLKTIQDMMHHNEAFEPGKPLFFHSWGFDFWRCYSSGKHVLETSGSSTMEQIAWIASAAVDTITNKEKEGVSFTSPYLLFLVPSQQKATEVRSVCKPLKAFGIHTVSLHSGASIDHQILGLK...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_012878 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_012878 |
|---|---|
| Location | Chr03:20279781-20281438 (-) |
| Description | Similar to ddx5: Probable ATP-dependent RNA helicase ddx5 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process GO:0006364 rRNA processing Biological Process GO:0008104 intracellular protein localization Biological Process GO:1903241 U2-type prespliceosome assembly Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0015030 Cajal body Cellular Component GO:0016020 membrane Cellular Component GO:0016607 nuclear speck Cellular Component GO:0071004 U2-type prespliceosome Cellular Component GO:0003676 nucleic acid binding Molecular Function |
| KEGG gene cross-reference | ddi:DDB_G0293036 gga:419959 hsa:11325 xla:380261 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.