LXL04_012771 | RubberDandelionOmics

Gene overview

LXL04_012771

Reference: OH-1004 Chr: Chr03 Coordinates: 18488125-18489979 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1095 bp · LXL04_012771|LXL04_012771|OH1004|cDNA

ATGGAGTCTGATAAAGAAGATGTTGTTTTCCTCGATCGAGCTTCTCGGGCAACGAGAGGGAGACGGATGACCAAGTTGGTTGATGAggagattgaagaagatgacgaGTTCTGGAACCAAGAGGCTTTGAAAGATGAAGAAGATGATACAAACTACGTAGAAGAAAAGGAGGCTGCAGATGTTTTTGACAGTGACTTTGATGAAGATGAACCGGAGCCAGATGAAGAAGCAGAAAATGAGCCAGATGAAAGGAAGAGGCC...

CDS

Download CDS FASTA

1095 bp · LXL04_012771|LXL04_012771|OH1004|CDS

ATGGAGTCTGATAAAGAAGATGTTGTTTTCCTCGATCGAGCTTCTCGGGCAACGAGAGGGAGACGGATGACCAAGTTGGTTGATGAGGAGATTGAAGAAGATGACGAGTTCTGGAACCAAGAGGCTTTGAAAGATGAAGAAGATGATACAAACTACGTAGAAGAAAAGGAGGCTGCAGATGTTTTTGACAGTGACTTTGATGAAGATGAACCGGAGCCAGATGAAGAAGCAGAAAATGAGCCAGATGAAAGGAAGAGGCC...

Protein

Download Protein FASTA

364 aa · LXL04_012771|LXL04_012771|OH1004|PROTEIN

MESDKEDVVFLDRASRATRGRRMTKLVDEEIEEDDEFWNQEALKDEEDDTNYVEEKEAADVFDSDFDEDEPEPDEEAENEPDERKRPKKRLPFPGKRMSFPGKQLPKKKKKKVVSEPESSNEEDTNVDQSTPQKDHDVVPDDTEVEKTTRKSTRTSVIVRQAEREAIHAALKATMKPIKRKKEGEEKRMTQEEMLLEAAQTEIMNLRNLERVLAREEEVKKRAIVHKAHYTGPQIRYLSKDGYSYLEFTNGVSFQSHIPT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012771`
TK1151 ID	TkAUNG060720
OH-1004 ID	LXL04_012771
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012771

Location Chr03:18488125-18489979 (+)

Description Similar to SWC2: SWR1 complex subunit 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36740`	Component of the SWR1 complex which mediates the ATP- dependent exchange of histone H2A for the H2A variant H2A.F/Z leading to transcriptional regulation of selected genes (e.g. FLC) by chromatin remodeling.	Arabidopsis homologs of components of the SWR1 complex regulate flowering and plant development.2007 · DOI: 10.1242/dev.001891

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012771 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009908 flower development Biological Process

GO:0030154 cell differentiation Biological Process

GO:0035019 somatic stem cell population maintenance Biological Process

GO:0045815 transcription initiation-coupled chromatin remodeling Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0051726 regulation of cell cycle Biological Process

GO:1905168 positive regulation of double-strand break repair via homologous recombination Biological Process

GO:2000779 regulation of double-strand break repair Biological Process

GO:0000786 nucleosome Cellular Component

KEGG gene cross-reference

ath:AT2G36740

bta:534883

hsa:6944

mmu:21427

pon:100173671

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.969

Rank 1 · LXL04_012771 · OH-1004

Cytoplasm0.136

Rank 2 · LXL04_012771 · OH-1004

Mitochondrion0.014

Rank 3 · LXL04_012771 · OH-1004

Cell membrane0.012

Rank 4 · LXL04_012771 · OH-1004

Extracellular0.006

Rank 5 · LXL04_012771 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05764.19YL113-239 aa

PF08265.17YL1_C270-298 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012771	`PF05764.19`	YL1	13	239	1.7e-38	133.8
LXL04_012771	`PF08265.17`	YL1_C	270	298	2.5e-16	59.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IP06`	Arabidopsis thaliana	SWR1 complex subunit 2	60.452%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card