LXL04_012727 | RubberDandelionOmics

Gene overview

LXL04_012727

Reference: OH-1004 Chr: Chr03 Coordinates: 17901311-17901682 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

372 bp · LXL04_012727|LXL04_012727|OH1004|cDNA

ATGAGGCTATTGACCCACAACATGCTCTCCTCGAACATCAAGGGAGTAATCAATGGCTTCCCTCTCCGAATCGAAGTAGAGAAAGTCATCGAAAAGCAAGTCGATTTCAATCCTGATTTCCTCAAGAACATGTTTTCCAAGATCGATTGGAAAGCCCTAGCCGACGCTTCAAAGATCATGGGATACGCAGAGCTCCCCGAAGAAGTCCCCGACGCGTCGGTGCTTGATTCCGATGAGTTTTTGCAGAAGTTCCACCACGC...

CDS

Download CDS FASTA

372 bp · LXL04_012727|LXL04_012727|OH1004|CDS

ATGAGGCTATTGACCCACAACATGCTCTCCTCGAACATCAAGGGAGTAATCAATGGCTTCCCTCTCCGAATCGAAGTAGAGAAAGTCATCGAAAAGCAAGTCGATTTCAATCCTGATTTCCTCAAGAACATGTTTTCCAAGATCGATTGGAAAGCCCTAGCCGACGCTTCAAAGATCATGGGATACGCAGAGCTCCCCGAAGAAGTCCCCGACGCGTCGGTGCTTGATTCCGATGAGTTTTTGCAGAAGTTCCACCACGC...

Protein

Download Protein FASTA

123 aa · LXL04_012727|LXL04_012727|OH1004|PROTEIN

MRLLTHNMLSSNIKGVINGFPLRIEVEKVIEKQVDFNPDFLKNMFSKIDWKALADASKIMGYAELPEEVPDASVLDSDEFLQKFHHALLELHLEEGALVCPETGRRFPVNKGIPNMLLHEDEV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012727`
TK1151 ID	TkA02G541240
OH-1004 ID	LXL04_012727
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 95.312 / OH-1004 99.187 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012727

Location Chr03:17901311-17901682 (+)

Description Similar to TRM112B: Multifunctional methyltransferase subunit TRM112 homolog B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g78190`	Acts as an activator of both rRNA/tRNA and protein methyltransferases (By similarity).	Roles of Trm9- and ALKBH8-like proteins in the formation of modified wobble uridines in Arabidopsis tRNA.2011 · DOI: 10.1093/nar/gkr406
`At1g22270`	Acts as an activator of both rRNA/tRNA and protein methyltransferases (By similarity).	Roles of Trm9- and ALKBH8-like proteins in the formation of modified wobble uridines in Arabidopsis tRNA.2011 · DOI: 10.1093/nar/gkr406

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012727 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000470 maturation of LSU-rRNA Biological Process

GO:0001510 RNA methylation Biological Process

GO:0002098 tRNA wobble uridine modification Biological Process

GO:0018364 peptidyl-glutamine methylation Biological Process

GO:0030488 tRNA methylation Biological Process

GO:0030490 maturation of SSU-rRNA Biological Process

GO:0031167 rRNA methylation Biological Process

GO:0035265 organ growth Biological Process

GO:0042127 regulation of cell population proliferation Biological Process

GO:0045815 transcription initiation-coupled chromatin remodeling Biological Process

GO:0051726 regulation of cell cycle Biological Process

GO:0070476 rRNA (guanine-N7)-methylation Biological Process

KEGG gene cross-reference

ath:AT1G22270

ath:AT1G78190

bta:507833

hsa:51504

mmu:67674

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.807

Rank 1 · LXL04_012727 · OH-1004

Nucleus0.401

Rank 2 · LXL04_012727 · OH-1004

Mitochondrion0.084

Rank 3 · LXL04_012727 · OH-1004

Endoplasmic reticulum0.069

Rank 4 · LXL04_012727 · OH-1004

Cell membrane0.055

Rank 5 · LXL04_012727 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03966.23Trm112p3-112 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012727	`PF03966.23`	Trm112p	3	112	7.5e-10	39.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C9R3`	Arabidopsis thaliana	Multifunctional methyltransferase subunit TRM112 homolog B	74.194%	Swiss-Prot	strong database homology
`Q8LFJ5`	Arabidopsis thaliana	Multifunctional methyltransferase subunit TRM112 homolog A	79.032%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card