Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1029 bp · LXL04_012567|LXL04_012567|OH1004|cDNA
ATGGCCGAGTATGAAGGAATTCTATTGGGAATGGGAAACCCCCTTCTCGACATTTCAGCCGTAGTCGACGAGGATTTCCTCAAAAAATATGGCATCCAACTAAACAATGCCATTCTTGCTGAAGAGAAGCATTTGTCCATGTACGATGAAATGTCATCCAAATTCAGTGTAGAGTACATTGCTGGAGGTGCTACTCAGAATTCAATCCGAGTTGCTCAGTGGATGCTTCAAATCCCTGGTGCAACAAGTTACATGGGCTG...
1029 bp · LXL04_012567|LXL04_012567|OH1004|CDS
ATGGCCGAGTATGAAGGAATTCTATTGGGAATGGGAAACCCCCTTCTCGACATTTCAGCCGTAGTCGACGAGGATTTCCTCAAAAAATATGGCATCCAACTAAACAATGCCATTCTTGCTGAAGAGAAGCATTTGTCCATGTACGATGAAATGTCATCCAAATTCAGTGTAGAGTACATTGCTGGAGGTGCTACTCAGAATTCAATCCGAGTTGCTCAGTGGATGCTTCAAATCCCTGGTGCAACAAGTTACATGGGCTG...
Protein
Download Protein FASTA342 aa · LXL04_012567|LXL04_012567|OH1004|PROTEIN
MAEYEGILLGMGNPLLDISAVVDEDFLKKYGIQLNNAILAEEKHLSMYDEMSSKFSVEYIAGGATQNSIRVAQWMLQIPGATSYMGCIGKDKYGEEMTKNSKSAGVNVHYYVDETAPTGTCAVCVVGGERSLIANLSAANCYKADHLKKPENWALVEKAKYIYIAGFFLTVSPESIQLVAEHAAAANKVFTMNLSAPFICEFFKDAQVKALQYVDYVFGNETEARTFSKVHGWETDNVEEIAIKISQWPKASGTFKRITV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_012567 |
|---|---|
| TK1151 ID | TkA02G552740 |
| OH-1004 ID | LXL04_012567 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_012567 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:14754144-14756675 (+) | |||||||||
| Description | Similar to ADK2: Adenosine kinase 2 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006144 purine nucleobase metabolic process Biological Process GO:0006166 purine ribonucleoside salvage Biological Process GO:0006169 adenosine salvage Biological Process GO:0006175 dATP biosynthetic process Biological Process GO:0009156 ribonucleoside monophosphate biosynthetic process Biological Process GO:0010613 positive regulation of cardiac muscle hypertrophy Biological Process GO:0032261 purine nucleotide salvage Biological Process GO:0044209 AMP salvage Biological Process GO:0044342 type B pancreatic cell proliferation Biological Process GO:0046085 adenosine metabolic process Biological Process GO:0080094 response to trehalose-6-phosphate Biological Process GO:0110052 toxic metabolite repair Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT3G09820 ath:AT5G03300 hsa:132 mmu:11534 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00294.30PfkB29-336 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_012567 | PF00294.30 | PfkB | 29 | 336 | 1.2e-74 | 252.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.