LXL04_012461 | RubberDandelionOmics

Gene overview

LXL04_012461

Reference: OH-1004 Chr: Chr03 Coordinates: 12568157-12569278 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1122 bp · LXL04_012461|LXL04_012461|OH1004|cDNA

ATGGCTCTATCCACTTCCACCCTTCTCAAAACTGCACTTTGCATCTTTTTACTATCAATTTCTCTTCAATGTTCTAGAGGGGCCCGCATCCTCACGGGAACAACCCCATTTTCAACCAACCAACACGACTCAACTAGTCCAATAGATGAAGACGATACCCCTGACGTGCCACCTCAAGTGGACCCCACACCCGACCTACCAACCAACGACACCCCCACCACCATCCCTCCCGCACCACTTGTCGCTCCTTCCATCCCATC...

CDS

Download CDS FASTA

1122 bp · LXL04_012461|LXL04_012461|OH1004|CDS

ATGGCTCTATCCACTTCCACCCTTCTCAAAACTGCACTTTGCATCTTTTTACTATCAATTTCTCTTCAATGTTCTAGAGGGGCCCGCATCCTCACGGGAACAACCCCATTTTCAACCAACCAACACGACTCAACTAGTCCAATAGATGAAGACGATACCCCTGACGTGCCACCTCAAGTGGACCCCACACCCGACCTACCAACCAACGACACCCCCACCACCATCCCTCCCGCACCACTTGTCGCTCCTTCCATCCCATC...

Protein

Download Protein FASTA

373 aa · LXL04_012461|LXL04_012461|OH1004|PROTEIN

MALSTSTLLKTALCIFLLSISLQCSRGARILTGTTPFSTNQHDSTSPIDEDDTPDVPPQVDPTPDLPTNDTPTTIPPAPLVAPSIPSPTTTSPTVATGVTTPVTAPAGGSATSGSTGAAGGSATVAGNVHATGAEHPTLSFFMHDIIGGSHAASRVVAGIVASSSANTVPFSTPNSQVFPITGGIPLNNINGIVNNNNLPFIAGFNGNNLNNNPNSNTVLQNTGNNNVANGGNNLPFVAAGQLPAGITLQQLMFGSITVI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012461`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012461

Location Chr03:12568157-12569278 (-)

Description Similar to DIR24: Dirigent protein 24

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55230`	Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism.	No verified direct reference in this release
`At2g39430`	Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism.	No verified direct reference in this release
`At1g07730`	Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism.	No verified direct reference in this release
`At2g28670`	Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism (By similarity).	Root suberin forms an extracellular barrier that affects water relations and mineral nutrition in Arabidopsis.2009 · DOI: 10.1371/journal.pgen.1000492 Water and solute permeabilities of Arabidopsis roots in relation to the amount and composition of aliphatic suberin.2011 · DOI: 10.1093/jxb/erq389
`At3g24020`	Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012461 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009699 phenylpropanoid biosynthetic process Biological Process

GO:0009809 lignin biosynthetic process Biological Process

GO:0010345 suberin biosynthetic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048046 apoplast Cellular Component

GO:0048226 Casparian strip Cellular Component

KEGG gene cross-reference

ath:AT1G07730

ath:AT2G28670

ath:AT2G39430

ath:AT3G24020

ath:AT3G55230

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.498

Rank 1 · LXL04_012461 · OH-1004

Endoplasmic reticulum0.182

Rank 2 · LXL04_012461 · OH-1004

Cytoplasm0.128

Rank 3 · LXL04_012461 · OH-1004

Cell membrane0.124

Rank 4 · LXL04_012461 · OH-1004

Lysosome / Vacuole0.069

Rank 5 · LXL04_012461 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03018.20Dirigent227-370 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012461	`PF03018.20`	Dirigent	227	370	1.7e-28	99.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M3C8`	Arabidopsis thaliana	Dirigent protein 24	55.466%	Swiss-Prot	moderate database homology
`O80630`	Arabidopsis thaliana	Dirigent protein 9	55.738%	Swiss-Prot	moderate database homology
`Q9LQQ0`	Arabidopsis thaliana	Dirigent protein 25	46.502%	Swiss-Prot	moderate database homology
`Q9SIA8`	Arabidopsis thaliana	Dirigent protein 10	48.148%	Swiss-Prot	moderate database homology
`Q7Y225`	Arabidopsis thaliana	Dirigent protein 16	34.177%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card