LXL04_012248 | RubberDandelionOmics

Gene overview

LXL04_012248

Reference: OH-1004 Chr: Chr03 Coordinates: 9060266-9064026 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2444 bp · LXL04_012248|LXL04_012248|OH1004|cDNA

ATGAGGTTCGGTTTCGACACACCGGAACCCAGCAGCAAAAAAGCCCTAACAACACAGTCTCAGTCACGGTCGCCGACCTCCGCTACTCCGACGAATGAAGAAGTGGAATGGGTTCCTCTTCAGAACCATCCAATTTTCTCCAATGCCACGGCCGCCCATTCATCGAATGACGTCCCGAAGAAACGAAACCTCATGGCTTGGGACGGAGCTTCTCGCCTCTACTACTGGGACATAAGTACGCAATCCCTACATCGAATTTC...

CDS

Download CDS FASTA

2424 bp · LXL04_012248|LXL04_012248|OH1004|CDS

ATGAGGTTCGGTTTCGACACACCGGAACCCAGCAGCAAAAAAGCCCTAACAACACAGTCTCAGTCACGGTCGCCGACCTCCGCTACTCCGACGAATGAAGAAGTGGAATGGGTTCCTCTTCAGAACCATCCAATTTTCTCCAATGCCACGGCCGCCCATTCATCGAATGACGTCCCGAAGAAACGAAACCTCATGGCTTGGGACGGAGCTTCTCGCCTCTACTACTGGGACATAAGTACGCAATCCCTACATCGAATTTC...

Protein

Download Protein FASTA

807 aa · LXL04_012248|LXL04_012248|OH1004|PROTEIN

MRFGFDTPEPSSKKALTTQSQSRSPTSATPTNEEVEWVPLQNHPIFSNATAAHSSNDVPKKRNLMAWDGASRLYYWDISTQSLHRISLRFGEPDPTYVLAASPSKVMRADVELSFMVDRITINRRGSALLLEGSDGIRVMDLYGKPSSKDSAIICRTVSIGSDVYFNTNNAIRTLKVSWHPYSDTHLGILSSDSVFRLYDLSSANEQPEQEYYLQPVDRGRSRNASSICPVDFSFGGDHLWDRFSVFILFSDGSVYILCP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012248`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012248

Location Chr03:9060266-9064026 (+)

Description Similar to NUP88: Nuclear pore complex protein NUP88

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g05680`	Involved in the regulation of exportin-mediated nuclear protein export.	Nuclear pore complex component MOS7/Nup88 is required for innate immunity and nuclear accumulation of defense regulators in Arabidopsis.2009 · DOI: 10.1105/tpc.108.064519

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012248 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000055 ribosomal large subunit export from nucleus Biological Process

GO:0000056 ribosomal small subunit export from nucleus Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0006606 protein import into nucleus Biological Process

GO:0006611 protein export from nucleus Biological Process

GO:0009627 systemic acquired resistance Biological Process

GO:0045087 innate immune response Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005643 nuclear pore Cellular Component

GO:0017056 structural constituent of nuclear pore Molecular Function

KEGG gene cross-reference

ath:AT5G05680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.480

Rank 1 · LXL04_012248 · OH-1004

Cytoplasm0.357

Rank 2 · LXL04_012248 · OH-1004

Lysosome / Vacuole0.114

Rank 3 · LXL04_012248 · OH-1004

Cell membrane0.083

Rank 4 · LXL04_012248 · OH-1004

Golgi apparatus0.074

Rank 5 · LXL04_012248 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10168.16Nup8840-234 aa

PF10168.16Nup88456-757 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012248	`PF10168.16`	Nup88	40	234	9.2e-27	93.9
LXL04_012248	`PF10168.16`	Nup88	456	757	9.2e-27	93.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFK6`	Arabidopsis thaliana	Nuclear pore complex protein NUP88	55.210%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card