LXL04_012192 | RubberDandelionOmics

Gene overview

LXL04_012192

Reference: OH-1004 Chr: Chr03 Coordinates: 8110798-8111433 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

636 bp · LXL04_012192|LXL04_012192|OH1004|cDNA

ATGCCTTCTTCCATTCAAGTTCAAAGAATCAACACCACCGCCACCCACCCCACCGTCACCGTCACGGCCAACATCAACCACCACAAAAACCCATCTACAACCACTATATGGAGAGTACCGTCGTCTATCTGGATCCCCGAAGATCTTATCCATCACCACACCCACGCGGTGGGTCCTCACCAGTGCTCCTCCGCCGTCGTCCAAACTATCTCCGCCCCCGTCGCTGACGTATGGTCCGTCGTCCGCCGCTTCGATAACCC...

CDS

Download CDS FASTA

636 bp · LXL04_012192|LXL04_012192|OH1004|CDS

ATGCCTTCTTCCATTCAAGTTCAAAGAATCAACACCACCGCCACCCACCCCACCGTCACCGTCACGGCCAACATCAACCACCACAAAAACCCATCTACAACCACTATATGGAGAGTACCGTCGTCTATCTGGATCCCCGAAGATCTTATCCATCACCACACCCACGCGGTGGGTCCTCACCAGTGCTCCTCCGCCGTCGTCCAAACTATCTCCGCCCCCGTCGCTGACGTATGGTCCGTCGTCCGCCGCTTCGATAACCC...

Protein

Download Protein FASTA

211 aa · LXL04_012192|LXL04_012192|OH1004|PROTEIN

MPSSIQVQRINTTATHPTVTVTANINHHKNPSTTTIWRVPSSIWIPEDLIHHHTHAVGPHQCSSAVVQTISAPVADVWSVVRRFDNPQAYKHFLKSCHVILGDGDVGTLREVHVVSGLPAGSSTERLEILDDDLHVMSFSVVGGDHRLNNYRSVTTLHASPNCDKTTVVVESYVVDVPPENTKEETCVFVDTIVRCNLISLKQIAENLSKK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012192`
TK1151 ID	TkA02G582550
OH-1004 ID	LXL04_012192
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012192

Location Chr03:8110798-8111433 (+)

Description Similar to PYL6: Abscisic acid receptor PYL6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g40330`	Receptor for abscisic acid (ABA) required for ABA-mediated responses such as stomatal closure and germination inhibition.	No verified direct reference in this release
`At2g38310`	Receptor for abscisic acid (ABA) required for ABA-mediated responses such as stomatal closure and germination inhibition.	No verified direct reference in this release
`At5g05440`	Receptor for abscisic acid (ABA) required for ABA-mediated responses such as stomatal closure and germination inhibition.	No verified direct reference in this release
`At1g01360`	Receptor for abscisic acid (ABA) required for ABA-mediated responses such as stomatal closure and germination inhibition.	Regulators of PP2C phosphatase activity function as abscisic acid sensors.2009 · DOI: 10.1126/science.1172408

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0213500`	Intracellular abscisic acid (ABA) receptor that functions as a positive regulator of ABA signaling pathway.	A rice orthologue of the ABA receptor, OsPYL/RCAR5, is a positive regulator of the ABA signal transduction pathway in seed germination and early seedling growth.2012 · DOI: 10.1093/jxb/err338 Overexpression of PYL5 in rice enhances drought tolerance, inhibits growth, and modulates gene expression.2014 · DOI: 10.1093/jxb/ert397

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012192 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009845 seed germination Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0090351 seedling development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

KEGG gene cross-reference

ath:AT1G01360

ath:AT2G38310

ath:AT2G40330

ath:AT5G05440

dosa:Os05g0213500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.597

Rank 1 · LXL04_012192 · OH-1004

Nucleus0.477

Rank 2 · LXL04_012192 · OH-1004

Cell membrane0.116

Rank 3 · LXL04_012192 · OH-1004

Endoplasmic reticulum0.061

Rank 4 · LXL04_012192 · OH-1004

Plastid0.054

Rank 5 · LXL04_012192 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10604.16Polyketide_cyc263-206 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012192	`PF10604.16`	Polyketide_cyc2	63	206	1.1e-14	55.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S8E3`	Arabidopsis thaliana	Abscisic acid receptor PYL6	59.346%	Swiss-Prot	strong database homology
`O80920`	Arabidopsis thaliana	Abscisic acid receptor PYL4	80.128%	Swiss-Prot	strong database homology
`Q9FLB1`	Arabidopsis thaliana	Abscisic acid receptor PYL5	68.098%	Swiss-Prot	strong database homology
`Q84MC7`	Arabidopsis thaliana	Abscisic acid receptor PYL9	53.416%	Swiss-Prot	strong database homology
`Q6I5C3`	Oryza sativa subsp. japonica	Abscisic acid receptor PYL5	56.329%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card