LXL04_012160 | RubberDandelionOmics

Gene overview

LXL04_012160

Reference: OH-1004 Chr: Chr03 Coordinates: 7543347-7545033 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1278 bp · LXL04_012160|LXL04_012160|OH1004|cDNA

ATGGGATCCCTGTGTCCAACAACCCTATCCCCTTTCCACCCCAAAACCCTAAAATTCTGTTCACCTGCGCAAAATCCTAACCACAGGCCATTTAGTCTCCCCTCTATCACAGCTGTTGCTTTGAGGTCTCACTATGAAACCGAAAGGGGTTTTGATTTCGAAATCGGAGACACCTTCTTCCGCCACGAAAGTGCTACCGGCCGAGATCTCGGTGTTCTCGCTGCGGCTCTATACAAGAAGCAAAACGATAACCTACGAGT...

CDS

Download CDS FASTA

1278 bp · LXL04_012160|LXL04_012160|OH1004|CDS

ATGGGATCCCTGTGTCCAACAACCCTATCCCCTTTCCACCCCAAAACCCTAAAATTCTGTTCACCTGCGCAAAATCCTAACCACAGGCCATTTAGTCTCCCCTCTATCACAGCTGTTGCTTTGAGGTCTCACTATGAAACCGAAAGGGGTTTTGATTTCGAAATCGGAGACACCTTCTTCCGCCACGAAAGTGCTACCGGCCGAGATCTCGGTGTTCTCGCTGCGGCTCTATACAAGAAGCAAAACGATAACCTACGAGT...

Protein

Download Protein FASTA

425 aa · LXL04_012160|LXL04_012160|OH1004|PROTEIN

MGSLCPTTLSPFHPKTLKFCSPAQNPNHRPFSLPSITAVALRSHYETERGFDFEIGDTFFRHESATGRDLGVLAAALYKKQNDNLRVLDAMCGCGIRSLRYLAEAKADFVLANDANEDCSGVIVSNLSTVSSEEEGRWKVNHAVANRVLAERYVEREFFDFIDVDSFGSDSSFFRCAFDVVKLGGLLYVTSTDGFSSGGHRPNHSLAAYGAYIRPLPYSNEIGLRMLIGGAVREASVLGYNVTPLFSYYSYHGPVFRVLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012160`
TK1151 ID	TkA02G584870
OH-1004 ID	LXL04_012160
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_012160`
Location	Chr03:7543347-7545033 (-)
Description	Similar to trm1: tRNA (guanine(26)-N(2))-dimethyltransferase (Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_012160` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0002940 tRNA N2-guanine methylation Biological Process GO:0008033 tRNA processing Biological Process GO:0030488 tRNA methylation Biological Process GO:0000049 tRNA binding Molecular Function GO:0046872 metal ion binding Molecular Function GO:0160103 tRNA (guanine(26)-N2/guanine(27)-N2)-dimethyltransferase activity Molecular Function GO:0160104 tRNA (guanine(26)-N2)-dimethyltransferase activity Molecular Function
KEGG gene cross-reference	sia:M1425_1283 sid:M164_1267 sin:YN1551_1580 siy:YG5714_1268 sso:SSO0943 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.722

Rank 1 · LXL04_012160 · OH-1004

Mitochondrion0.293

Rank 2 · LXL04_012160 · OH-1004

Nucleus0.065

Rank 3 · LXL04_012160 · OH-1004

Cytoplasm0.041

Rank 4 · LXL04_012160 · OH-1004

Peroxisome0.011

Rank 5 · LXL04_012160 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02005.23TRM59-419 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012160	`PF02005.23`	TRM	59	419	2.1e-58	199.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card