LXL04_012152 | RubberDandelionOmics

Gene overview

LXL04_012152

Reference: OH-1004 Chr: Chr03 Coordinates: 7388840-7406388 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4320 bp · LXL04_012152|LXL04_012152|OH1004|cDNA

ATGGCGACTGAGAAGGAAAGAAGTGAATTTGATACAGGAGGGGCAGACCTCGGTAGTCCAATCGAGTCCAGAAGGATGGCAGAGATGGATGAATTCGATTTCATGGGTAGATGGAGTAATGATGTTAATGGCGTCGATGTGAGAGCAGCGATTGATGGAGTTATGGCGTGCAGCTGGTTTATGCTTATAAGAACCATGAACATGACAAGTGGCATTTTGGATTGTGAGTGTGCCACATATGTGGAAACAGGATTAAAGAA...

CDS

Download CDS FASTA

4320 bp · LXL04_012152|LXL04_012152|OH1004|CDS

ATGGCGACTGAGAAGGAAAGAAGTGAATTTGATACAGGAGGGGCAGACCTCGGTAGTCCAATCGAGTCCAGAAGGATGGCAGAGATGGATGAATTCGATTTCATGGGTAGATGGAGTAATGATGTTAATGGCGTCGATGTGAGAGCAGCGATTGATGGAGTTATGGCGTGCAGCTGGTTTATGCTTATAAGAACCATGAACATGACAAGTGGCATTTTGGATTGTGAGTGTGCCACATATGTGGAAACAGGATTAAAGAA...

Protein

Download Protein FASTA

1439 aa · LXL04_012152|LXL04_012152|OH1004|PROTEIN

MATEKERSEFDTGGADLGSPIESRRMAEMDEFDFMGRWSNDVNGVDVRAAIDGVMACSWFMLIRTMNMTSGILDCECATYVETGLKKRYKTVGPVTANIQEKKGSKGKKTKVSAYCLSEKEKNLERKESAAHGGRNPQSRLYRLLSGNEKHLKFTSDIFVVNFSVCFEARAFEMRKLLGICLFLLAAHVIIVKSLNPTLDDDVLGLIVFKADLQDPDGKLVSWNEDDDSPCKWKGVKCNPRSNRVSDLVLDGFGLSGKMG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012152`
TK1151 ID	TkA02G585150
OH-1004 ID	LXL04_012152
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 67.616 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012152

Location Chr03:7388840-7406388 (+)

Description Similar to IRK: Probable LRR receptor-like serine/threonine-protein kinase IRK

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g56370`	Probable LRR receptor-like serine/threonine-protein kinase IRK.	No verified direct reference in this release
`At5g01890`	Leucine-rich repeat receptor-like protein kinase that may play a role in vascular tissues development.	No verified direct reference in this release
`At3g28040`	Probably inactive leucine-rich repeat receptor-like protein kinase At3g28040.	No verified direct reference in this release
`At1g12460`	Probable LRR receptor-like serine/threonine-protein kinase At1g12460.	No verified direct reference in this release
`At4g28650`	Involved in the regulation of procambium maintenance and polarity during vascular-tissue development.	A receptor heteromer mediates the male perception of female attractants in plants.2016 · DOI: 10.1038/nature16975

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012152 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0010067 procambium histogenesis Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0030154 cell differentiation Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0048364 root development Biological Process

GO:0051302 regulation of cell division Biological Process

GO:0090511 periclinal cell division Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0090406 pollen tube Cellular Component

KEGG gene cross-reference

ath:AT1G12460

ath:AT3G28040

ath:AT3G56370

ath:AT4G28650

ath:AT5G01890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.825

Rank 1 · LXL04_012152 · OH-1004

Endoplasmic reticulum0.088

Rank 2 · LXL04_012152 · OH-1004

Cytoplasm0.083

Rank 3 · LXL04_012152 · OH-1004

Nucleus0.077

Rank 4 · LXL04_012152 · OH-1004

Lysosome / Vacuole0.023

Rank 5 · LXL04_012152 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_2199-239 aa

PF12799.14LRR_4269-301 aa

PF13855.13LRR_8317-374 aa

PF23598.2LRR_14360-571 aa

PF13855.13LRR_8440-495 aa

PF24141.2LRR_ComC547-668 aa

PF13855.13LRR_8558-596 aa

PF23598.2LRR_14558-715 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012152	`PF08263.18`	LRRNT_2	199	239	4e-12	46.9
LXL04_012152	`PF12799.14`	LRR_4	269	301	1.3e-30	105.5
LXL04_012152	`PF13855.13`	LRR_8	317	374	3.8e-42	142.6
LXL04_012152	`PF23598.2`	LRR_14	360	571	3.4e-28	99.1
LXL04_012152	`PF13855.13`	LRR_8	440	495	3.8e-42	142.6
LXL04_012152	`PF24141.2`	LRR_ComC	547	668	6e-10	40.0
LXL04_012152	`PF13855.13`	LRR_8	558	596	3.8e-42	142.6
LXL04_012152	`PF23598.2`	LRR_14	558	715	3.4e-28	99.1
LXL04_012152	`PF12799.14`	LRR_4	560	594	1.3e-30	105.5
LXL04_012152	`PF12799.14`	LRR_4	584	621	1.3e-30	105.5
LXL04_012152	`PF13855.13`	LRR_8	602	644	3.8e-42	142.6
LXL04_012152	`PF13855.13`	LRR_8	657	716	3.8e-42	142.6
LXL04_012152	`PF07714.24`	PK_Tyr_Ser-Thr	860	1130	1.9e-42	146.1
LXL04_012152	`PF00069.32`	Pkinase	861	1069	1.6e-38	133.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LY03`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase IRK	67.629%	Swiss-Prot	moderate database homology
`Q9LZV7`	Arabidopsis thaliana	Leucine-rich repeat receptor-like protein kinase PXC2	57.585%	Swiss-Prot	moderate database homology
`Q9LRT1`	Arabidopsis thaliana	Probably inactive leucine-rich repeat receptor-like protein kinase At3g28040	43.251%	Swiss-Prot	moderate database homology
`C0LGE4`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At1g12460	34.318%	Swiss-Prot	moderate database homology
`Q9M0G7`	Arabidopsis thaliana	MDIS1-interacting receptor like kinase 1	32.258%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card