LXL04_012123 | RubberDandelionOmics

Gene overview

LXL04_012123

Reference: OH-1004 Chr: Chr03 Coordinates: 6916787-6918435 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1035 bp · LXL04_012123|LXL04_012123|OH1004|cDNA

ATGGAGGCGGAGCTAAAAGAGCTATTCGAGGCGGCCAAGAAAGCTGCAGACGCCGCGGCTGTCGACGGCGGTGGTGCAGGTTCTTCGCCGGAGGAAGAACGCTGTGTTGATGCCTTGAATGCTCTGAAGAAATTTCCTGTTAACTATCAAATTCTCGTTTCCACTCAGGTTGGGAAGCGACTTCGTCAGCTAACAAAACACCCGAGAAAGAAGATTCAGTCACTAGCCGCAGAGATGGTCGAAATTTGGAAAAACATAAT...

CDS

Download CDS FASTA

1035 bp · LXL04_012123|LXL04_012123|OH1004|CDS

ATGGAGGCGGAGCTAAAAGAGCTATTCGAGGCGGCCAAGAAAGCTGCAGACGCCGCGGCTGTCGACGGCGGTGGTGCAGGTTCTTCGCCGGAGGAAGAACGCTGTGTTGATGCCTTGAATGCTCTGAAGAAATTTCCTGTTAACTATCAAATTCTCGTTTCCACTCAGGTTGGGAAGCGACTTCGTCAGCTAACAAAACACCCGAGAAAGAAGATTCAGTCACTAGCCGCAGAGATGGTCGAAATTTGGAAAAACATAAT...

Protein

Download Protein FASTA

344 aa · LXL04_012123|LXL04_012123|OH1004|PROTEIN

MEAELKELFEAAKKAADAAAVDGGGAGSSPEEERCVDALNALKKFPVNYQILVSTQVGKRLRQLTKHPRKKIQSLAAEMVEIWKNIIVEETLKNKKNGTTDTKESPKSENGPQTSTKKPIQKSNSIKIETLSKTETIKIEKHIQTTTTTTQEDKTVNPVKAGPPKLTSLVYCKDPVRDKIRELLSEALCKVCNEVDDELRHEVDASDPYRVAVSVESAMFEKWGRSNGAQKFKYRSIMFNIKDPKNPDFRRKVLLGHVKP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012123`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012123

Location Chr03:6916787-6918435 (+)

Description Similar to TFIIS: Transcription elongation factor TFIIS

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g38560`	Necessary for efficient RNA polymerase II transcription elongation past template-encoded arresting sites (Probable).	Transcript elongation factor TFIIS is involved in arabidopsis seed dormancy.2009 · DOI: 10.1016/j.jmb.2008.12.066 Identification of the Arabidopsis REDUCED DORMANCY 2 gene uncovers a role for the polymerase associated factor 1 complex in seed dormancy.2011 · DOI: 10.1371/journal.pone.0022241

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012123 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006354 DNA-templated transcription elongation Biological Process

GO:0006368 transcription elongation by RNA polymerase II Biological Process

GO:0009408 response to heat Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009845 seed germination Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0010162 seed dormancy process Biological Process

GO:0032784 regulation of DNA-templated transcription elongation Biological Process

GO:0034243 regulation of transcription elongation by RNA polymerase II Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT2G38560

bta:505722

bta:507729

hsa:6919

mmu:21399

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.695

Rank 1 · LXL04_012123 · OH-1004

Cytoplasm0.317

Rank 2 · LXL04_012123 · OH-1004

Cell membrane0.046

Rank 3 · LXL04_012123 · OH-1004

Mitochondrion0.039

Rank 4 · LXL04_012123 · OH-1004

Endoplasmic reticulum0.031

Rank 5 · LXL04_012123 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08711.17Med2637-87 aa

PF07500.20TFIIS_M173-290 aa

PF01096.24Zn_ribbon_TFIIS304-342 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012123	`PF08711.17`	Med26	37	87	1.4e-13	51.1
LXL04_012123	`PF07500.20`	TFIIS_M	173	290	8e-34	117.2
LXL04_012123	`PF01096.24`	Zn_ribbon_TFIIS	304	342	4.8e-18	65.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZVH8`	Arabidopsis thaliana	Transcription elongation factor TFIIS	53.298%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card