LXL04_012065 | RubberDandelionOmics

Gene overview

LXL04_012065

Reference: OH-1004 Chr: Chr03 Coordinates: 5744655-5746412 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

864 bp · LXL04_012065|LXL04_012065|OH1004|cDNA

ATGGCTGTCGCTTCTGCACAAAGAAACCGACACCTAATCAAAATCAGAAATGCCGACTCTGATGAATTTGCGTTTCTTTTTAGCAGCAAGGCTGGTGGATGTGGGTTAAACTTGATAGGTGGAAATAAACTTGttttatttgatcctgattggAATCTAGCCAATGACAAACAAGCAGCTGCAAGAGTGTGGAGAGACAGCCAGAAGAAACGAGTATACATCTATAGGTTTTTGAGCACCAGAACTATTGAAGAGAAGGT...

CDS

Download CDS FASTA

864 bp · LXL04_012065|LXL04_012065|OH1004|CDS

ATGGCTGTCGCTTCTGCACAAAGAAACCGACACCTAATCAAAATCAGAAATGCCGACTCTGATGAATTTGCGTTTCTTTTTAGCAGCAAGGCTGGTGGATGTGGGTTAAACTTGATAGGTGGAAATAAACTTGTTTTATTTGATCCTGATTGGAATCTAGCCAATGACAAACAAGCAGCTGCAAGAGTGTGGAGAGACAGCCAGAAGAAACGAGTATACATCTATAGGTTTTTGAGCACCAGAACTATTGAAGAGAAGGT...

Protein

Download Protein FASTA

287 aa · LXL04_012065|LXL04_012065|OH1004|PROTEIN

MAVASAQRNRHLIKIRNADSDEFAFLFSSKAGGCGLNLIGGNKLVLFDPDWNLANDKQAAARVWRDSQKKRVYIYRFLSTRTIEEKVYQRQMSKEGLQKMMCTRCHKSEEQEQETDLDINSDEEDIGEFAGISGCLHKLKKSEKQVGRPLEEDLGRWGHHATPNTVPDSIFQASGDDVTFVFTNQISGKLVPLEPVDKSKANVEANSEKGNSISYKSHVISSSKRLKTIPLSFRSKLPSFVKPSLHKESSIIRPTTTNVE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012065`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012065

Location Chr03:5744655-5746412 (+)

Description Similar to CHR25: Protein CHROMATIN REMODELING 25

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g19210`	Dissociates RAD51 from nucleoprotein filaments formed on dsDNA.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0762800`	Multifunctional ATPase that plays a role in homologous recombination (HR) which is a major pathway for repairing DNA double-strand breaks (DSBs), single-stranded DNA (ssDNA) gaps, and stalled or collapsed replication forks.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012065 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007131 reciprocal meiotic recombination Biological Process

GO:0008340 determination of adult lifespan Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0010212 response to ionizing radiation Biological Process

GO:0010332 response to gamma radiation Biological Process

GO:0045003 double-strand break repair via synthesis-dependent strand annealing Biological Process

GO:0051276 chromosome organization Biological Process

GO:0051301 cell division Biological Process

GO:0051701 biological process involved in interaction with host Biological Process

KEGG gene cross-reference

ath:AT3G19210

dosa:Os02g0762800

dre:394119

gga:424611

mmu:19366

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.932

Rank 1 · LXL04_012065 · OH-1004

Cytoplasm0.156

Rank 2 · LXL04_012065 · OH-1004

Mitochondrion0.026

Rank 3 · LXL04_012065 · OH-1004

Cell membrane0.018

Rank 4 · LXL04_012065 · OH-1004

Endoplasmic reticulum0.010

Rank 5 · LXL04_012065 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00271.38Helicase_C7-65 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012065	`PF00271.38`	Helicase_C	7	65	2.6e-08	34.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0PCS3`	Arabidopsis thaliana	Protein CHROMATIN REMODELING 25	55.462%	Swiss-Prot	moderate database homology
`A4PBL4`	Oryza sativa subsp. japonica	DNA repair and recombination protein RAD54	42.571%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card