LXL04_011631 | RubberDandelionOmics

Gene overview

LXL04_011631

Reference: OH-1004 Chr: Chr02 Coordinates: 168584657-168586018 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1362 bp · LXL04_011631|LXL04_011631|OH1004|cDNA

ATGAAATTCCGTTCATTACTATCAACATGCTCCGCCACCATCTGCACCACTACAGAAGACGACACCACCATATCACAACGGCAAAAGTCCGGACCACCGCCACCTAAACTCCGATTCTTCGACACAAGCAGTAGCATCTCCGATACCACCACCACGGGCACCAGTCCATCAATCGACACCAGTTACAGTTACAGCAGTAGCCTCCACAGCAACCTCTCTCTTCAAACATTACCCTCCGTCCCTTCCCTCCAGAAACTCTC...

CDS

Download CDS FASTA

1362 bp · LXL04_011631|LXL04_011631|OH1004|CDS

ATGAAATTCCGTTCATTACTATCAACATGCTCCGCCACCATCTGCACCACTACAGAAGACGACACCACCATATCACAACGGCAAAAGTCCGGACCACCGCCACCTAAACTCCGATTCTTCGACACAAGCAGTAGCATCTCCGATACCACCACCACGGGCACCAGTCCATCAATCGACACCAGTTACAGTTACAGCAGTAGCCTCCACAGCAACCTCTCTCTTCAAACATTACCCTCCGTCCCTTCCCTCCAGAAACTCTC...

Protein

Download Protein FASTA

453 aa · LXL04_011631|LXL04_011631|OH1004|PROTEIN

MKFRSLLSTCSATICTTTEDDTTISQRQKSGPPPPKLRFFDTSSSISDTTTTGTSPSIDTSYSYSSSLHSNLSLQTLPSVPSLQKLSPDTLNLTVSHGYLTSIKPSPAGRVNYLAVHNHLLYAASGNLIHVFNTTSFALLDMFSVNDSSSGSVKSVTFHNGKVFTAHQDSKIRVWKLTENKHHKHTVTLPTLEDRLLRSILSKNYVNVRRHRRRLWIEHHDAVTGLSMIDNQLMCSVSWDKYLKIWNTSNLRCVESIKAH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011631`
TK1151 ID	TkA03G607120
OH-1004 ID	LXL04_011631
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011631

Location Chr02:168584657-168586018 (-)

Description Similar to JGB: Protein JINGUBANG

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26490`	Negative regulator of pollen germination.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011631 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000209 protein polyubiquitination Biological Process

GO:0000281 mitotic cytokinesis Biological Process

GO:0006508 proteolysis Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0008285 negative regulation of cell population proliferation Biological Process

GO:0009846 pollen germination Biological Process

GO:0010826 negative regulation of centrosome duplication Biological Process

GO:0031037 myosin II filament disassembly Biological Process

GO:0031647 regulation of protein stability Biological Process

GO:0051301 cell division Biological Process

GO:0051726 regulation of cell cycle Biological Process

GO:0061136 regulation of proteasomal protein catabolic process Biological Process

KEGG gene cross-reference

ath:AT2G26490

cel:CELE_K10B2.1

ddi:DDB_G0289115

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.449

Rank 1 · LXL04_011631 · OH-1004

Cytoplasm0.385

Rank 2 · LXL04_011631 · OH-1004

Cell membrane0.168

Rank 3 · LXL04_011631 · OH-1004

Endoplasmic reticulum0.062

Rank 4 · LXL04_011631 · OH-1004

Lysosome / Vacuole0.062

Rank 5 · LXL04_011631 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25171.2Beta-prop_WDR36-Utp21_1st103-191 aa

PF25172.2Beta-prop_WDR3_2nd111-380 aa

PF24782.3WD40_MABP1-WDR62_2nd155-422 aa

PF25174.2Beta-prop_THOC3217-424 aa

PF25047.1Beta-prop_TEP1_2nd217-289 aa

PF25173.2Beta-prop_WDR3_1st218-287 aa

PF25175.2Beta-prop_WDR5219-341 aa

PF24807.2WD40_CDC20-Fz219-379 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011631	`PF25171.2`	Beta-prop_WDR36-Utp21_1st	103	191	1.6e-11	44.9
LXL04_011631	`PF25172.2`	Beta-prop_WDR3_2nd	111	380	9.9e-23	81.5
LXL04_011631	`PF24782.3`	WD40_MABP1-WDR62_2nd	155	422	1.3e-10	41.5
LXL04_011631	`PF25174.2`	Beta-prop_THOC3	217	424	5.1e-27	95.3
LXL04_011631	`PF25047.1`	Beta-prop_TEP1_2nd	217	289	6.7e-16	58.9
LXL04_011631	`PF25173.2`	Beta-prop_WDR3_1st	218	287	2.6e-31	109.5
LXL04_011631	`PF25175.2`	Beta-prop_WDR5	219	341	4.6e-37	128.6
LXL04_011631	`PF24807.2`	WD40_CDC20-Fz	219	379	7.7e-17	62.2
LXL04_011631	`PF24796.2`	WDR55	221	287	3.5e-15	56.5
LXL04_011631	`PF20426.5`	NBCH_WD40	228	289	4.5e-10	39.6
LXL04_011631	`PF24814.2`	WD40_Prp19	229	337	1.8e-25	90.3
LXL04_011631	`PF24817.2`	WD40_WDHD1_1st	230	379	2.1e-14	54.1
LXL04_011631	`PF23414.2`	Beta-prop_EML_2	230	358	2.1e-10	41.2
LXL04_011631	`PF23393.3`	Beta-prop_WDR90_POC16_2nd	233	338	1.6e-08	34.9
LXL04_011631	`PF23381.2`	Beta-prop_IFT122_1st	236	290	6.7e-23	82.1
LXL04_011631	`PF25171.2`	Beta-prop_WDR36-Utp21_1st	237	377	1.6e-11	44.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O48716`	Arabidopsis thaliana	Protein JINGUBANG	40.950%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card