LXL04_011589 | RubberDandelionOmics

Gene overview

LXL04_011589

Reference: OH-1004 Chr: Chr02 Coordinates: 167785361-167790606 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

999 bp · LXL04_011589|LXL04_011589|OH1004|cDNA

ATGGAAGAGATGTACGGTTTCCATTCCATGTCCGATTACACTATTCCACCGGAGACTAACCTGATTTCGCCGTCTGAGTACCACGGCGATTTCTCAGCTTCCGTTGATCATTACCGGACGTTTTACGGATCGGATGATCTACTATCGGCGACTGCTTCTATCATAACCGAAGCTGTTTCCATCGCTGCAACGCCCGATCAGATTCTCCTTCCGAGGCGTCGAACCATTCGACACCGTGATCATGATAAAAACGATAACGT...

CDS

Download CDS FASTA

999 bp · LXL04_011589|LXL04_011589|OH1004|CDS

ATGGAAGAGATGTACGGTTTCCATTCCATGTCCGATTACACTATTCCACCGGAGACTAACCTGATTTCGCCGTCTGAGTACCACGGCGATTTCTCAGCTTCCGTTGATCATTACCGGACGTTTTACGGATCGGATGATCTACTATCGGCGACTGCTTCTATCATAACCGAAGCTGTTTCCATCGCTGCAACGCCCGATCAGATTCTCCTTCCGAGGCGTCGAACCATTCGACACCGTGATCATGATAAAAACGATAACGT...

Protein

Download Protein FASTA

332 aa · LXL04_011589|LXL04_011589|OH1004|PROTEIN

MEEMYGFHSMSDYTIPPETNLISPSEYHGDFSASVDHYRTFYGSDDLLSATASIITEAVSIAATPDQILLPRRRTIRHRDHDKNDNVNDAHHVDACDEIIKSKIVSHPSYPKLLDAFIDCQKLGAPPEIVCLLDEIRRQKDVCMRNAAVSTCSGADPELDEFMETYCQVLVKYKSDLARPFDEATVFLHNIETQLGNLCKDDGTLSSEEEQEFSGGETETTQVSREDQELKDTLLRKFGGHISSLKHEFSKKKKKGKLPN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011589`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011589

Location Chr02:167785361-167790606 (+)

Description Similar to KNAT6: Homeobox protein knotted-1-like 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g23380`	Plays a role in meristem function.	KNAT6: an Arabidopsis homeobox gene involved in meristem activity and organ separation.2006 · DOI: 10.1105/tpc.106.041988
`At1g70510`	May play a role in meristem function, and may be involved in maintaining cells in an undifferentiated, meristematic state.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011589 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0009888 tissue development Biological Process

GO:0009901 anther dehiscence Biological Process

GO:0010073 meristem maintenance Biological Process

GO:0010094 specification of carpel identity Biological Process

GO:0010497 plasmodesmata-mediated intercellular transport Biological Process

GO:0010930 negative regulation of auxin mediated signaling pathway Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G23380

ath:AT1G70510

sly:544007

zma:542391

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.959

Rank 1 · LXL04_011589 · OH-1004

Cytoplasm0.123

Rank 2 · LXL04_011589 · OH-1004

Cell membrane0.025

Rank 3 · LXL04_011589 · OH-1004

Endoplasmic reticulum0.014

Rank 4 · LXL04_011589 · OH-1004

Mitochondrion0.011

Rank 5 · LXL04_011589 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03790.19KNOX1100-140 aa

PF03791.19KNOX2153-199 aa

PF03789.19ELK229-250 aa

PF05920.18Homeobox_KN269-308 aa

PF00046.36Homeodomain276-309 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011589	`PF03790.19`	KNOX1	100	140	5.4e-20	71.6
LXL04_011589	`PF03791.19`	KNOX2	153	199	8.6e-25	86.7
LXL04_011589	`PF03789.19`	ELK	229	250	4.9e-10	39.8
LXL04_011589	`PF05920.18`	Homeobox_KN	269	308	4.4e-18	65.6
LXL04_011589	`PF00046.36`	Homeodomain	276	309	3.5e-06	27.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84JS6`	Arabidopsis thaliana	Homeobox protein knotted-1-like 6	56.772%	Swiss-Prot	strong database homology
`P46640`	Arabidopsis thaliana	Homeobox protein knotted-1-like 2	54.079%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card