LXL04_011568 | RubberDandelionOmics

Gene overview

LXL04_011568

Reference: OH-1004 Chr: Chr02 Coordinates: 167459811-167469004 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5349 bp · LXL04_011568|LXL04_011568|OH1004|cDNA

ATGGAAATTTCGGATCCGGGTAGTTCATCTGTACCCGGAAACAGTGCCCATACAGTAGCGTTGGAGTTCGATTTGAACGAAACCCCACTCCCTTCTTCCGGAGAAGAAGCTGCGGGTGGTAATGGCGACGGGTCTACGGCGGATCACCGGTGTTGCTCATGTTGTGAGGCGAAAGGGAAGGTGGTGGTATGCTGTGAGTGTGCAAAACATTTTCAAGTAGAGTGTTTTAGGGGGAGACTAGGAGGGAGGGAGAGGACGTG...

CDS

Download CDS FASTA

5349 bp · LXL04_011568|LXL04_011568|OH1004|CDS

ATGGAAATTTCGGATCCGGGTAGTTCATCTGTACCCGGAAACAGTGCCCATACAGTAGCGTTGGAGTTCGATTTGAACGAAACCCCACTCCCTTCTTCCGGAGAAGAAGCTGCGGGTGGTAATGGCGACGGGTCTACGGCGGATCACCGGTGTTGCTCATGTTGTGAGGCGAAAGGGAAGGTGGTGGTATGCTGTGAGTGTGCAAAACATTTTCAAGTAGAGTGTTTTAGGGGGAGACTAGGAGGGAGGGAGAGGACGTG...

Protein

Download Protein FASTA

1782 aa · LXL04_011568|LXL04_011568|OH1004|PROTEIN

MEISDPGSSSVPGNSAHTVALEFDLNETPLPSSGEEAAGGNGDGSTADHRCCSCCEAKGKVVVCCECAKHFQVECFRGRLGGRERTCSECLMECSSGKRLRRTVSATSGGDLGLMDMNVSPPREVEGDDVGVWVNSESAFTNSAPKMQDTYCNNLFTEFTLTSCNNTSTHHPQHVTNGFPSTTIETNDNSLISLQNGSQSHAIKTMEPTSKSLKVSNGGNAVKVDSMENGNHGFPVQFEDFFVISVGKVNPRRSFHTSHQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011568`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011568

Location Chr02:167459811-167469004 (+)

Description Similar to MBD9: Methyl-CpG-binding domain-containing protein 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01460`	Probable transcriptional regulator that acts as a histone acetyltransferase.	AtMBD9: a protein with a methyl-CpG-binding domain regulates flowering time and shoot branching in Arabidopsis.2006 · DOI: 10.1111/j.1365-313x.2006.02691.x AtMBD9 modulates Arabidopsis development through the dual epigenetic pathways of DNA methylation and histone acetylation.2009 · DOI: 10.1111/j.1365-313x.2009.03860.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011568 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0006397 mRNA processing Biological Process

GO:0010223 secondary shoot formation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0048573 photoperiodism, flowering Biological Process

GO:0000812 Swr1 complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT3G01460

hsa:57661

mmu:101471

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.933

Rank 1 · LXL04_011568 · OH-1004

Cytoplasm0.104

Rank 2 · LXL04_011568 · OH-1004

Cell membrane0.044

Rank 3 · LXL04_011568 · OH-1004

Endoplasmic reticulum0.020

Rank 4 · LXL04_011568 · OH-1004

Plastid0.016

Rank 5 · LXL04_011568 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05964.20FYRN234-268 aa

PF00628.36PHD1016-1060 aa

PF15612.12WHIM11097-1139 aa

PF15613.12WSD1148-1224 aa

PF31066.1DUF87991330-1395 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011568	`PF05964.20`	FYRN	234	268	1.8e-06	28.1
LXL04_011568	`PF00628.36`	PHD	1016	1060	4.5e-11	43.3
LXL04_011568	`PF15612.12`	WHIM1	1097	1139	2.9e-08	33.9
LXL04_011568	`PF15613.12`	WSD	1148	1224	7.5e-09	36.4
LXL04_011568	`PF31066.1`	DUF8799	1330	1395	4.2e-06	27.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SGH2`	Arabidopsis thaliana	Methyl-CpG-binding domain-containing protein 9	36.718%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card