LXL04_011409 | RubberDandelionOmics

Gene overview

LXL04_011409

Reference: OH-1004 Chr: Chr02 Coordinates: 163883806-163887928 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1776 bp · LXL04_011409|LXL04_011409|OH1004|cDNA

ATGGCGACGCGCCAGCTCCTGAAGCTCTCTCGCCGCTCTCATCCAACCCTAGCAGCCACTACCACCACCACCAGATCTGCTTCAACTGCCACCGCAGTCTCAACCGCATCCGATACTCGCGCACCAGCTCCACCACATCCTAATCAAATGATCTATGATCGCGTTTCAGAACAAGTGAAATCGAAGCTCAAACGACTCGAAAATCCTGATCCTAGGTTCCTTAAACATAACTCACCTTTCCCTGCTTTATCCGATCATAC...

CDS

Download CDS FASTA

1776 bp · LXL04_011409|LXL04_011409|OH1004|CDS

ATGGCGACGCGCCAGCTCCTGAAGCTCTCTCGCCGCTCTCATCCAACCCTAGCAGCCACTACCACCACCACCAGATCTGCTTCAACTGCCACCGCAGTCTCAACCGCATCCGATACTCGCGCACCAGCTCCACCACATCCTAATCAAATGATCTATGATCGCGTTTCAGAACAAGTGAAATCGAAGCTCAAACGACTCGAAAATCCTGATCCTAGGTTCCTTAAACATAACTCACCTTTCCCTGCTTTATCCGATCATAC...

Protein

Download Protein FASTA

591 aa · LXL04_011409|LXL04_011409|OH1004|PROTEIN

MATRQLLKLSRRSHPTLAATTTTTRSASTATAVSTASDTRAPAPPHPNQMIYDRVSEQVKSKLKRLENPDPRFLKHNSPFPALSDHTSILSYPETRVTTLPNGLRVATESNLASQTATVGVWIDAGSRFETEETNGVAHFLEHMIFKGTEKRSVRDLEEEIENMGGHLNAYTSREQTTYYAKVMGGDVPKALDILSDILQNSNFDERLINRERSVILREMEEVGLQTEEVIFDHLHATAFQYTPLGRTILGPAENIEKIT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011409`
TK1151 ID	TkA03G586350
OH-1004 ID	LXL04_011409
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.100
Protein coverage (%)	TK1151 86.420 / OH-1004 47.377 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011409

Location Chr02:163883806-163887928 (-)

Description Similar to MPPbeta: Probable mitochondrial-processing peptidase subunit beta, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g02090`	Catalytic subunit of the essential mitochondrial processing protease (MPP), which cleaves the mitochondrial sequence off newly imported precursors proteins (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011409 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006627 protein processing involved in protein targeting to mitochondrion Biological Process

GO:0006851 mitochondrial calcium ion transmembrane transport Biological Process

GO:0016485 protein processing Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005758 mitochondrial intermembrane space Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009505 plant-type cell wall Cellular Component

KEGG gene cross-reference

ath:AT3G02090

bta:534546

hsa:9512

mmu:73078

rno:64198

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.945

Rank 1 · LXL04_011409 · OH-1004

Cytoplasm0.050

Rank 2 · LXL04_011409 · OH-1004

Nucleus0.043

Rank 3 · LXL04_011409 · OH-1004

Cell membrane0.018

Rank 4 · LXL04_011409 · OH-1004

Plastid0.014

Rank 5 · LXL04_011409 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00675.26Peptidase_M16105-252 aa

PF05193.27Peptidase_M16_C258-444 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011409	`PF00675.26`	Peptidase_M16	105	252	2.3e-54	184.1
LXL04_011409	`PF05193.27`	Peptidase_M16_C	258	444	6e-41	141.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42290`	Arabidopsis thaliana	Probable mitochondrial-processing peptidase subunit beta, mitochondrial	72.190%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card