LXL04_011317 | RubberDandelionOmics

Gene overview

LXL04_011317

Reference: OH-1004 Chr: Chr02 Coordinates: 162430143-162433329 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2646 bp · LXL04_011317|LXL04_011317|OH1004|cDNA

ATGGCTGCTTCGGTGTCGTCATCGTCGTCGGCGACAAACATCATGCTTGCAATCTATGAGAAGAAAACCGTTGCGGTCGATCTTTATCGTCCTCTCCGCAACTACATAGTCTTCAATTACTCCGAGCGCGAGGCTCAAAACCTCGAAGACGATCTCGAAACCCTAAAGGAGATGCGCAACAGCATAGAACGTTCCTCAGCTGCCGACTCCCTCCCTGCGCGCCGAGATATTCTCCAGAACTACTTTAAAGCCCTAACCGC...

CDS

Download CDS FASTA

2646 bp · LXL04_011317|LXL04_011317|OH1004|CDS

ATGGCTGCTTCGGTGTCGTCATCGTCGTCGGCGACAAACATCATGCTTGCAATCTATGAGAAGAAAACCGTTGCGGTCGATCTTTATCGTCCTCTCCGCAACTACATAGTCTTCAATTACTCCGAGCGCGAGGCTCAAAACCTCGAAGACGATCTCGAAACCCTAAAGGAGATGCGCAACAGCATAGAACGTTCCTCAGCTGCCGACTCCCTCCCTGCGCGCCGAGATATTCTCCAGAACTACTTTAAAGCCCTAACCGC...

Protein

Download Protein FASTA

881 aa · LXL04_011317|LXL04_011317|OH1004|PROTEIN

MAASVSSSSSATNIMLAIYEKKTVAVDLYRPLRNYIVFNYSEREAQNLEDDLETLKEMRNSIERSSAADSLPARRDILQNYFKALTAVESRFPISADKDHVNSVTFTWHDAFKNKNKASQQNIHLEKAAILFNLGAVHSQIGLTFDRSTVEGRRQASHSFIAAAGAFAFLRDNAATKASIGSSTTVDISVECAGMLERLMLAQAQECVFENTIAKGSTPGVCSKISRQVGLYYEEALAALTVAPLTQHFDKTWLSHVQLK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011317`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011317

Location Chr02:162430143-162433329 (+)

Description Similar to BRO1: Vacuolar-sorting protein BRO1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g15130`	Class E VPS protein involved in concentration and sorting of cargo proteins of the multivesicular body (MVB) for incorporation into intralumenal vesicles.	Arabidopsis ALIX is required for the endosomal localization of the deubiquitinating enzyme AMSH3.2015 · DOI: 10.1073/pnas.1510516112 ESCRT-III-Associated Protein ALIX Mediates High-Affinity Phosphate Transporter Trafficking to Maintain Phosphate Homeostasis in Arabidopsis.2015 · DOI: 10.1105/tpc.15.00393

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011317 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0000915 actomyosin contractile ring assembly Biological Process

GO:0007033 vacuole organization Biological Process

GO:0009653 anatomical structure morphogenesis Biological Process

GO:0010824 regulation of centrosome duplication Biological Process

GO:0015031 protein transport Biological Process

GO:0016236 macroautophagy Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0036257 multivesicular body organization Biological Process

GO:0039702 viral budding via host ESCRT complex Biological Process

GO:0042318 penicillin biosynthetic process Biological Process

GO:0043328 protein transport to vacuole involved in ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway Biological Process

KEGG gene cross-reference

ani:ANIA_04351

ath:AT1G15130

cnb:CNBG4510

ddi:DDB_G0275451

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.701

Rank 1 · LXL04_011317 · OH-1004

Cell membrane0.180

Rank 2 · LXL04_011317 · OH-1004

Golgi apparatus0.156

Rank 3 · LXL04_011317 · OH-1004

Nucleus0.154

Rank 4 · LXL04_011317 · OH-1004

Lysosome / Vacuole0.079

Rank 5 · LXL04_011317 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03097.25BRO115-396 aa

PF13949.12ALIX_LYPXL_bnd432-716 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011317	`PF03097.25`	BRO1	15	396	8.5e-107	358.1
LXL04_011317	`PF13949.12`	ALIX_LYPXL_bnd	432	716	1.9e-74	251.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HXZ1`	Arabidopsis thaliana	Vacuolar-sorting protein BRO1	68.907%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card