LXL04_011151 | RubberDandelionOmics

Gene overview

LXL04_011151

Reference: OH-1004 Chr: Chr02 Coordinates: 159014677-159019619 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1686 bp · LXL04_011151|LXL04_011151|OH1004|cDNA

ATGAAGGAAAAGATGAACGGGTTCGCTCTTGAAGATGCCATAGCCGCCAGGTTTCAAAATTACATCATCAACGATCTCAATGGTTATGATATGAAGCTGATAATCAGAAAGAAACTGTATGCAAGCGATATTTCGAAAACTCAAAGCCGGTTGAGTATGCCGATGAAGCAACTGGAAACACATGAATTCTTGACAGATTATGAGAAACAAGAACTGGAAAACGAGAAGGAGTTTCCGGTGCGATTGTTGGGGCCGTCAAT...

CDS

Download CDS FASTA

1686 bp · LXL04_011151|LXL04_011151|OH1004|CDS

ATGAAGGAAAAGATGAACGGGTTCGCTCTTGAAGATGCCATAGCCGCCAGGTTTCAAAATTACATCATCAACGATCTCAATGGTTATGATATGAAGCTGATAATCAGAAAGAAACTGTATGCAAGCGATATTTCGAAAACTCAAAGCCGGTTGAGTATGCCGATGAAGCAACTGGAAACACATGAATTCTTGACAGATTATGAGAAACAAGAACTGGAAAACGAGAAGGAGTTTCCGGTGCGATTGTTGGGGCCGTCAAT...

Protein

Download Protein FASTA

561 aa · LXL04_011151|LXL04_011151|OH1004|PROTEIN

MKEKMNGFALEDAIAARFQNYIINDLNGYDMKLIIRKKLYASDISKTQSRLSMPMKQLETHEFLTDYEKQELENEKEFPVRLLGPSMRMHNKSMMLKMWKLSSTSSYVLKTYWNEFVKENDEVLKVDAKICVWSFRVEGMLCYALACMDDFTIKQNVLDHVRYLIDYHQNRISFRTMDIMSTIVVTPFITHLNLEIFFDELVKMNGNNGGFMWRGRGTGAPNACYIEMILRRRKGWILHDNLIFYIDVVKDDDQFSNLCG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011151`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011151

Location Chr02:159014677-159019619 (+)

Description Similar to At2g27410: Putative B3 domain-containing protein At2g27410

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g27410`	Putative B3 domain-containing protein At2g27410.	No verified direct reference in this release
`At3g25182`	B3 domain-containing protein At3g25182.	No verified direct reference in this release
`At2g32645`	B3 domain-containing protein At2g32645.	No verified direct reference in this release
`At2g31720`	B3 domain-containing protein At2g31720.	No verified direct reference in this release
`At3g24850`	Putative B3 domain-containing protein At3g24850.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011151 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G27410

ath:AT2G32645

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.857

Rank 1 · LXL04_011151 · OH-1004

Cytoplasm0.191

Rank 2 · LXL04_011151 · OH-1004

Cell membrane0.028

Rank 3 · LXL04_011151 · OH-1004

Mitochondrion0.025

Rank 4 · LXL04_011151 · OH-1004

Endoplasmic reticulum0.018

Rank 5 · LXL04_011151 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03754.20At2g31720-like23-146 aa

PF31239.1At5g26805_C35-133 aa

PF03754.20At2g31720-like423-547 aa

PF31239.1At5g26805_C436-546 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011151	`PF03754.20`	At2g31720-like	23	146	1.5e-58	197.3
LXL04_011151	`PF31239.1`	At5g26805_C	35	133	1.4e-10	42.3
LXL04_011151	`PF03754.20`	At2g31720-like	423	547	1.5e-58	197.3
LXL04_011151	`PF31239.1`	At5g26805_C	436	546	1.4e-10	42.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XIP5`	Arabidopsis thaliana	Putative B3 domain-containing protein At2g27410	30.570%	Swiss-Prot	weak database homology
`Q9LSF7`	Arabidopsis thaliana	B3 domain-containing protein At3g25182	28.767%	Swiss-Prot	weak database homology
`Q1G3B8`	Arabidopsis thaliana	B3 domain-containing protein At2g32645	35.659%	Swiss-Prot	weak database homology
`Q8RV83`	Arabidopsis thaliana	B3 domain-containing protein At2g31720	27.136%	Swiss-Prot	weak database homology
`Q9LRX6`	Arabidopsis thaliana	Putative B3 domain-containing protein At3g24850	31.707%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card