LXL04_011079 | RubberDandelionOmics

Gene overview

LXL04_011079

Reference: OH-1004 Chr: Chr02 Coordinates: 157652791-157656178 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1536 bp · LXL04_011079|LXL04_011079|OH1004|cDNA

ATGCCACCGTACCGAAAGCAGATCCTCATTGGTAGAGGACGAGGAGACCAATTTCAATCAATCGTCGAACTTCCAAAGGTTAACGATAAGGAAGTTGTACCATGGGTCTGCGAGGAACTGGAGAAGATTCTGTTCTTCCACCCAGCTGATCTACCCTTTCCAGCTCAACTCTCTGTTATTGGTCTCAGTGAAGGCCTCATCACTTTCACAAGAATTTTTTCTCCTGAAGCAGCTTGTGAGGTTATAGAAGCAGAAATGCA...

CDS

Download CDS FASTA

1536 bp · LXL04_011079|LXL04_011079|OH1004|CDS

ATGCCACCGTACCGAAAGCAGATCCTCATTGGTAGAGGACGAGGAGACCAATTTCAATCAATCGTCGAACTTCCAAAGGTTAACGATAAGGAAGTTGTACCATGGGTCTGCGAGGAACTGGAGAAGATTCTGTTCTTCCACCCAGCTGATCTACCCTTTCCAGCTCAACTCTCTGTTATTGGTCTCAGTGAAGGCCTCATCACTTTCACAAGAATTTTTTCTCCTGAAGCAGCTTGTGAGGTTATAGAAGCAGAAATGCA...

Protein

Download Protein FASTA

511 aa · LXL04_011079|LXL04_011079|OH1004|PROTEIN

MPPYRKQILIGRGRGDQFQSIVELPKVNDKEVVPWVCEELEKILFFHPADLPFPAQLSVIGLSEGLITFTRIFSPEAACEVIEAEMHSHVFFEPEPDIWMVMVVEKSKETEAIFRTEALRTILKEIHSLFIMFHGSIRVLLDKEPGGGLTRSHLHTFIMDYLTDFLMGNKFVLPNFRDSLKERGTVQMLTVGREAAIEVQSLVGALDSCMANTLGYSVILFQDLLVSTTLSPEDTTNLFSYSTLRLTPRVLSSSSGGTST...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011079`
TK1151 ID	TkA03G564910
OH-1004 ID	LXL04_011079
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.300
Protein coverage (%)	TK1151 94.380 / OH-1004 92.759 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011079

Location Chr02:157652791-157656178 (-)

Description Similar to CCZ1B: Vacuolar fusion protein CCZ1 homolog B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80910`	Plays an important role in membrane trafficking through the secretory apparatus.	No verified direct reference in this release
`At1g16020`	Plays an important role in membrane trafficking through the secretory apparatus.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0427300`	Plays an important role in membrane trafficking through the secretory apparatus.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011079 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007034 vacuolar transport Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005765 lysosomal membrane Cellular Component

GO:0005770 late endosome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0035658 Mon1-Ccz1 complex Cellular Component

GO:0005085 guanyl-nucleotide exchange factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G16020

ath:AT1G80910

dosa:Os08g0427300

hsa:221960

hsa:51622

mmu:231874

osa:4345617

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.409

Rank 1 · LXL04_011079 · OH-1004

Nucleus0.250

Rank 2 · LXL04_011079 · OH-1004

Golgi apparatus0.221

Rank 3 · LXL04_011079 · OH-1004

Endoplasmic reticulum0.172

Rank 4 · LXL04_011079 · OH-1004

Lysosome / Vacuole0.093

Rank 5 · LXL04_011079 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19031.7Intu_longin_138-135 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011079	`PF19031.7`	Intu_longin_1	38	135	3.5e-17	63.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C0Z274`	Arabidopsis thaliana	Vacuolar fusion protein CCZ1 homolog B	65.010%	Swiss-Prot	strong database homology
`F4I2S4`	Arabidopsis thaliana	Vacuolar fusion protein CCZ1 homolog A	61.122%	Swiss-Prot	strong database homology
`Q7EY72`	Oryza sativa subsp. japonica	Vacuolar fusion protein CCZ1 homolog	61.555%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card