RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_010954
Reference: OH-1004 Chr: Chr02 Coordinates: 155626497-155630384 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3210 bp · LXL04_010954|LXL04_010954|OH1004|cDNA

ATGAATAAATCGAATTTAGAACCCGATTACCAAACATTCGCAGCCACACTTAAATCATGTGCTGCAAAATTCAACATCAAACTGGGAAAATGTCTTCATAGCTCTGTAATCAAACATGGTTTACACTCCTGTGTCCTCGTCTCCAAATCACTGCTTAATATGTACGCAAAATGTAAAGCTCTTGACGATTGCCATATCCTTTTTAACCAGATAACCCATCCGGATGCTGTCACCTGGAACATTATGCTTTCTGGTTTAGC...

CDS

Download CDS FASTA

3210 bp · LXL04_010954|LXL04_010954|OH1004|CDS

ATGAATAAATCGAATTTAGAACCCGATTACCAAACATTCGCAGCCACACTTAAATCATGTGCTGCAAAATTCAACATCAAACTGGGAAAATGTCTTCATAGCTCTGTAATCAAACATGGTTTACACTCCTGTGTCCTCGTCTCCAAATCACTGCTTAATATGTACGCAAAATGTAAAGCTCTTGACGATTGCCATATCCTTTTTAACCAGATAACCCATCCGGATGCTGTCACCTGGAACATTATGCTTTCTGGTTTAGC...

Protein

Download Protein FASTA

1069 aa · LXL04_010954|LXL04_010954|OH1004|PROTEIN

MNKSNLEPDYQTFAATLKSCAAKFNIKLGKCLHSSVIKHGLHSCVLVSKSLLNMYAKCKALDDCHILFNQITHPDAVTWNIMLSGLAGTRIHDLEVIKLYNAMNLVQHFKPSSVTVAIVLPVCVRLKSLNLGKNVHSYAIKSGLESQTLVGNALVSLYFKLGCVSGDAYQVFDEMSERDVVSWNAMVAGLVENGMFPEAFSMFRQMIVEGTSPNYATIANILPICTHHFGKQIHCYTIRREELFLDTSVTNSLLGFYSKT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_010954
TK1151 IDTkA03G558090
OH-1004 IDLXL04_010954
Relationship / confidenceSequence Supported Annotation Or Model Conflict / Review
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 20.674
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_010954
LocationChr02:155626497-155630384 (-)
DescriptionSimilar to PCMP-E32: Putative pentatricopeptide repeat-containing protein At5g08490
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g08490 Putative pentatricopeptide repeat-containing protein At5g08490. No verified direct reference in this release
At3g63370 Involved in RNA editing event in chloroplasts.
A study of new Arabidopsis chloroplast RNA editing mutants reveals general features of editing factors and their target sites.2009 · DOI: 10.1105/tpc.109.071472
At2g40720 Pentatricopeptide repeat-containing protein At2g40720. No verified direct reference in this release
At4g18750 Plays a major role in single RNA editing events in chloroplasts.
Identification of two pentatricopeptide repeat genes required for RNA editing and zinc binding by C-terminal cytidine deaminase-like domains.2013 · DOI: 10.1074/jbc.m113.485755
At3g22150 Pentatricopeptide repeat-containing protein At3g22150, chloroplastic. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_010954 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006397 mRNA processing Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009451 RNA modification Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0031425 chloroplast RNA processing Biological Process
GO:0080156 mitochondrial mRNA modification Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0003723 RNA binding Molecular Function
GO:0003729 mRNA binding Molecular Function
GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference
ath:AT2G40720
ath:AT3G63370
ath:AT5G08490
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.664
Rank 1 · LXL04_010954 · OH-1004
Plastid0.158
Rank 2 · LXL04_010954 · OH-1004
Nucleus0.080
Rank 3 · LXL04_010954 · OH-1004
Cytoplasm0.042
Rank 4 · LXL04_010954 · OH-1004
Peroxisome0.008
Rank 5 · LXL04_010954 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041.13PPR_2178-217 aa
PF01535.27PPR181-210 aa
PF13041.13PPR_2277-325 aa
PF01535.27PPR279-303 aa
PF13041.13PPR_2510-548 aa
PF01535.27PPR513-540 aa
PF13041.13PPR_2610-657 aa
PF01535.27PPR612-641 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_010954PF13041.13PPR_21782176.4e-62206.2
LXL04_010954PF01535.27PPR1812101.8e-56185.2
LXL04_010954PF13041.13PPR_22773256.4e-62206.2
LXL04_010954PF01535.27PPR2793031.8e-56185.2
LXL04_010954PF13041.13PPR_25105486.4e-62206.2
LXL04_010954PF01535.27PPR5135401.8e-56185.2
LXL04_010954PF13041.13PPR_26106576.4e-62206.2
LXL04_010954PF01535.27PPR6126411.8e-56185.2
LXL04_010954PF20431.5E_motif7277891.9e-1867.2
LXL04_010954PF18345.8zf_CCCH_49299471e-0732.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FNN9Arabidopsis thalianaPutative pentatricopeptide repeat-containing protein At5g0849049.400%Swiss-Protmoderate database homology
Q9M1V3Arabidopsis thalianaPentatricopeptide repeat-containing protein At3g63370, chloroplastic30.314%Swiss-Protmoderate database homology
Q7XJN6Arabidopsis thalianaPentatricopeptide repeat-containing protein At2g4072032.254%Swiss-Protmoderate database homology
Q9SN39Arabidopsis thalianaPentatricopeptide repeat-containing protein DOT4, chloroplastic32.129%Swiss-Protmoderate database homology
Q9LIE7Arabidopsis thalianaPentatricopeptide repeat-containing protein At3g22150, chloroplastic31.347%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser