LXL04_010814 | RubberDandelionOmics

Gene overview

LXL04_010814

Reference: OH-1004 Chr: Chr02 Coordinates: 153890451-153897945 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5212 bp · LXL04_010814|LXL04_010814|OH1004|cDNA

ATGGAGATTATATCAGCTATCATGGGTCCAATTGTTGAAAGTGTATTGGTTCCTATTAAGAGACATGTGAGTTATCTGTTTTCCTCCACAAAACATGTTAGGAAAATGGATACTCGAATAAAGCAACTGGATGGTACAAGCATTGATGccaaaaagaaaaaggagaCGAACATCACCGGCAATCTCGAAATTCCAACTCGTGTACCGGATTGGTTGGAAGAAGTTGAAGATGTTAAGAAACGTGCTCATAGCATTTCAAG...

CDS

Download CDS FASTA

5205 bp · LXL04_010814|LXL04_010814|OH1004|CDS

ATGGAGATTATATCAGCTATCATGGGTCCAATTGTTGAAAGTGTATTGGTTCCTATTAAGAGACATGTGAGTTATCTGTTTTCCTCCACAAAACATGTTAGGAAAATGGATACTCGAATAAAGCAACTGGATGGTACAAGCATTGATGCCAAAAAGAAAAAGGAGACGAACATCACCGGCAATCTCGAAATTCCAACTCGTGTACCGGATTGGTTGGAAGAAGTTGAAGATGTTAAGAAACGTGCTCATAGCATTTCAAG...

Protein

Download Protein FASTA

1734 aa · LXL04_010814|LXL04_010814|OH1004|PROTEIN

MEIISAIMGPIVESVLVPIKRHVSYLFSSTKHVRKMDTRIKQLDGTSIDAKKKKETNITGNLEIPTRVPDWLEEVEDVKKRAHSISSTGYGCFNMKMRYRTGRNAFKITKEIVILDEEYSKIIWNDTPRPLGKVNSMTASTSARLDGDSQNDFRSREKSFNDALSFLQQNHTSQVIGLCGMGGVGKTTMMEQLKKATIEKKTFDYVVKVVIGQQINMFSLQQAVAEYMGQALNETSKTARADRLRITFEKLPEGRRKVLV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010814`
TK1151 ID	TkA03G549500
OH-1004 ID	LXL04_010814
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	87.600
Protein coverage (%)	TK1151 99.774 / OH-1004 99.942 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010814

Location Chr02:153890451-153897945 (+)

Description Similar to At4g27190: Disease resistance protein At4g27190

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27190`	Disease resistance protein.	No verified direct reference in this release
`At4g27220`	Probable disease resistance protein.	No verified direct reference in this release
`At4g26090`	Disease resistance (R) protein that specifically recognizes the AvrRpt2 type III effector avirulence protein from Pseudomonas syringae.	No verified direct reference in this release
`At5g47250`	Probable disease resistance protein.	No verified direct reference in this release
`At1g63350`	Potential disease resistance protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010814 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002220 innate immune response activating cell surface receptor signaling pathway Biological Process

GO:0006952 defense response Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0016045 detection of bacterium Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT1G63350

ath:AT4G26090

ath:AT4G27190

ath:AT4G27220

ath:AT5G47250

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.560

Rank 1 · LXL04_010814 · OH-1004

Cytoplasm0.290

Rank 2 · LXL04_010814 · OH-1004

Nucleus0.222

Rank 3 · LXL04_010814 · OH-1004

Endoplasmic reticulum0.085

Rank 4 · LXL04_010814 · OH-1004

Extracellular0.047

Rank 5 · LXL04_010814 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00931.29NB-ARC157-299 aa

PF23598.2LRR_14585-692 aa

PF23247.2LRR_RPS2739-866 aa

PF23247.2LRR_RPS2895-1033 aa

PF23247.2LRR_RPS21085-1187 aa

PF23247.2LRR_RPS21161-1249 aa

PF23247.2LRR_RPS21281-1354 aa

PF23247.2LRR_RPS21348-1447 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010814	`PF00931.29`	NB-ARC	157	299	9.6e-25	87.9
LXL04_010814	`PF23598.2`	LRR_14	585	692	1.1e-11	44.9
LXL04_010814	`PF23247.2`	LRR_RPS2	739	866	4.1e-105	349.4
LXL04_010814	`PF23247.2`	LRR_RPS2	895	1033	4.1e-105	349.4
LXL04_010814	`PF23247.2`	LRR_RPS2	1085	1187	4.1e-105	349.4
LXL04_010814	`PF23247.2`	LRR_RPS2	1161	1249	4.1e-105	349.4
LXL04_010814	`PF23247.2`	LRR_RPS2	1281	1354	4.1e-105	349.4
LXL04_010814	`PF23247.2`	LRR_RPS2	1348	1447	4.1e-105	349.4
LXL04_010814	`PF23247.2`	LRR_RPS2	1499	1633	4.1e-105	349.4
LXL04_010814	`PF23247.2`	LRR_RPS2	1617	1695	4.1e-105	349.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9T048`	Arabidopsis thaliana	Disease resistance protein At4g27190	22.823%	Swiss-Prot	weak database homology
`O81825`	Arabidopsis thaliana	Probable disease resistance protein At4g27220	24.845%	Swiss-Prot	weak database homology
`Q42484`	Arabidopsis thaliana	Disease resistance protein RPS2	25.806%	Swiss-Prot	weak database homology
`Q9LVT4`	Arabidopsis thaliana	Probable disease resistance protein At5g47250	26.275%	Swiss-Prot	weak database homology
`Q9C8T9`	Arabidopsis thaliana	Putative disease resistance protein At1g63350	24.949%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card