LXL04_010735 | RubberDandelionOmics

Gene overview

LXL04_010735

Reference: OH-1004 Chr: Chr02 Coordinates: 152411783-152414053 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1935 bp · LXL04_010735|LXL04_010735|OH1004|cDNA

ATGCATATACGATGTCAGATGTTCTGTTTTCGTTTCTTCATCACCATGATCATCGTCATCATCATTTCACTGCTACTTCTGCCATCTTCACAGCCCTCGCCAGTCAATTGCCCACCTGAAAGATGTGGGACCTTCGACTCCATACCCTACCCGTTTCACTTAAACAACGGTTCAGATTGCGGGGAGTATATACTTTCAGACGCCTTCCATCTCTCCTGCGCTAATTCGACCTCTCTGTTCCTCACCATCGGATCTCACAG...

CDS

Download CDS FASTA

1935 bp · LXL04_010735|LXL04_010735|OH1004|CDS

ATGCATATACGATGTCAGATGTTCTGTTTTCGTTTCTTCATCACCATGATCATCGTCATCATCATTTCACTGCTACTTCTGCCATCTTCACAGCCCTCGCCAGTCAATTGCCCACCTGAAAGATGTGGGACCTTCGACTCCATACCCTACCCGTTTCACTTAAACAACGGTTCAGATTGCGGGGAGTATATACTTTCAGACGCCTTCCATCTCTCCTGCGCTAATTCGACCTCTCTGTTCCTCACCATCGGATCTCACAG...

Protein

Download Protein FASTA

644 aa · LXL04_010735|LXL04_010735|OH1004|PROTEIN

MHIRCQMFCFRFFITMIIVIIISLLLLPSSQPSPVNCPPERCGTFDSIPYPFHLNNGSDCGEYILSDAFHLSCANSTSLFLTIGSHRYQVLDFFPDGGGVLVDFPNNTITYSSNCRRYYDLRLFGFQANDYLGISSDNVVGLYGCGDSSLCRSDCGGCHDANATTTFASSGCCYLLSDNRGGVWRVGDGFSVFEEFGCKGFASWVGSSSNNVAVKHGVKLEWAIPSKLIGGVCDSNALMVNVTSVISGMRCKCVDGFVGD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010735`
TK1151 ID	TkA03G545800
OH-1004 ID	LXL04_010735
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.300
Protein coverage (%)	TK1151 92.971 / OH-1004 63.665 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010735

Location Chr02:152411783-152414053 (+)

Description Similar to At2g46850: Probably inactive receptor-like protein kinase At2g46850

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g46850`	Probably inactive receptor-like protein kinase At2g46850.	No verified direct reference in this release
`At2g23450`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release
`At5g66790`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release
`At5g02070`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release
`At1g21240`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010735 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0010089 xylem development Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0030247 polysaccharide binding Molecular Function

GO:0044589 pectin binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G21240

ath:AT2G23450

ath:AT2G46850

ath:AT5G02070

ath:AT5G66790

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.851

Rank 1 · LXL04_010735 · OH-1004

Endoplasmic reticulum0.087

Rank 2 · LXL04_010735 · OH-1004

Cytoplasm0.086

Rank 3 · LXL04_010735 · OH-1004

Nucleus0.076

Rank 4 · LXL04_010735 · OH-1004

Lysosome / Vacuole0.024

Rank 5 · LXL04_010735 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13947.12GUB_WAK_bind37-95 aa

PF07714.24PK_Tyr_Ser-Thr365-509 aa

PF00069.32Pkinase368-508 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010735	`PF13947.12`	GUB_WAK_bind	37	95	1.1e-09	39.3
LXL04_010735	`PF07714.24`	PK_Tyr_Ser-Thr	365	509	5.9e-18	65.8
LXL04_010735	`PF00069.32`	Pkinase	368	508	2.7e-09	37.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S8N4`	Arabidopsis thaliana	Probably inactive receptor-like protein kinase At2g46850	47.702%	Swiss-Prot	moderate database homology
`Q8RY67`	Arabidopsis thaliana	Wall-associated receptor kinase-like 14	34.389%	Swiss-Prot	moderate database homology
`Q8GYF5`	Arabidopsis thaliana	Wall-associated receptor kinase-like 21	27.692%	Swiss-Prot	weak database homology
`Q9LZM4`	Arabidopsis thaliana	Wall-associated receptor kinase-like 20	24.806%	Swiss-Prot	weak database homology
`Q9LMN8`	Arabidopsis thaliana	Wall-associated receptor kinase 3	24.478%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card