LXL04_010616 | RubberDandelionOmics

Gene overview

LXL04_010616

Reference: OH-1004 Chr: Chr02 Coordinates: 149683089-149699181 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5913 bp · LXL04_010616|LXL04_010616|OH1004|cDNA

ATGAAGCATGAAGCTGAAGCCATCGACCAAATTGTTAAAGAAATTTCAATGAAGCTTCATTCCATTCATTTGGTCAATGATGAAAATCTGATAGGTCTGGACCGCCCGATGCAAGAGCTGGAGTCATCTTTGGGGATCAGTTTGAACGATGAGGTGCGGATGATAGGGATCAAGGGGATGGGAGGCATTGGTAAGACAACATTAGCCAGAGCTATTTTTGATAAAGTATCTTCTCATTTTGAAGGTAAACGTAAGGGAAG...

CDS

Download CDS FASTA

5913 bp · LXL04_010616|LXL04_010616|OH1004|CDS

ATGAAGCATGAAGCTGAAGCCATCGACCAAATTGTTAAAGAAATTTCAATGAAGCTTCATTCCATTCATTTGGTCAATGATGAAAATCTGATAGGTCTGGACCGCCCGATGCAAGAGCTGGAGTCATCTTTGGGGATCAGTTTGAACGATGAGGTGCGGATGATAGGGATCAAGGGGATGGGAGGCATTGGTAAGACAACATTAGCCAGAGCTATTTTTGATAAAGTATCTTCTCATTTTGAAGGTAAACGTAAGGGAAG...

Protein

Download Protein FASTA

1970 aa · LXL04_010616|LXL04_010616|OH1004|PROTEIN

MKHEAEAIDQIVKEISMKLHSIHLVNDENLIGLDRPMQELESSLGISLNDEVRMIGIKGMGGIGKTTLARAIFDKVSSHFEGKRKGSFKKERLGVIARTSPFKKHMRVESVYEGERIMRMRLPYKKVLLVLDDVDDTKQLEVLAGDWFKDGSRIIITTRDEKVLLAHGVNADWIHDVSLVLDEEGLSLFCRYAFKRYISDEGYEKLSLEVVCYAAGLPLTIKVLGSHLCGENKDVWTDALKRLETIPSRETLEILEISYN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010616`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010616

Location Chr02:149683089-149699181 (-)

Description Similar to N: TMV resistance protein N

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44510`	TIR-NB-LRR receptor-like protein that contributes to disease resistance induced by the Pseudomonas syringae type III effector AvrB.	Arabidopsis TAO1 is a TIR-NB-LRR protein that contributes to disease resistance induced by the Pseudomonas syringae effector AvrB.2008 · DOI: 10.1073/pnas.0802157105
`At4g12010`	TIR-NB-LRR receptor-like protein involved in plant defense.	Matching NLR Immune Receptors to Autoimmunity in camta3 Mutants Using Antimorphic NLR Alleles.2017 · DOI: 10.1016/j.chom.2017.03.005

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010616 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0043531 ADP binding Molecular Function

GO:0061809 NAD+ nucleosidase activity, cyclic ADP-ribose generating Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.586

Rank 1 · LXL04_010616 · OH-1004

Nucleus0.255

Rank 2 · LXL04_010616 · OH-1004

Cell membrane0.189

Rank 3 · LXL04_010616 · OH-1004

Endoplasmic reticulum0.075

Rank 4 · LXL04_010616 · OH-1004

Extracellular0.065

Rank 5 · LXL04_010616 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00931.29NB-ARC49-196 aa

PF23598.2LRR_14246-386 aa

PF13855.13LRR_8251-306 aa

PF01582.26TIR381-532 aa

PF13676.12TIR_2393-460 aa

PF00931.29NB-ARC556-713 aa

PF05729.19NACHT561-708 aa

PF23282.2WHD_ROQ1780-836 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010616	`PF00931.29`	NB-ARC	49	196	7.4e-43	146.8
LXL04_010616	`PF23598.2`	LRR_14	246	386	8.3e-65	219.6
LXL04_010616	`PF13855.13`	LRR_8	251	306	2.6e-24	85.4
LXL04_010616	`PF01582.26`	TIR	381	532	2e-32	113.1
LXL04_010616	`PF13676.12`	TIR_2	393	460	7e-08	33.7
LXL04_010616	`PF00931.29`	NB-ARC	556	713	7.4e-43	146.8
LXL04_010616	`PF05729.19`	NACHT	561	708	1e-10	42.4
LXL04_010616	`PF23282.2`	WHD_ROQ1	780	836	6.9e-27	94.1
LXL04_010616	`PF23598.2`	LRR_14	1090	1150	8.3e-65	219.6
LXL04_010616	`PF23598.2`	LRR_14	1148	1223	8.3e-65	219.6
LXL04_010616	`PF23598.2`	LRR_14	1232	1362	8.3e-65	219.6
LXL04_010616	`PF23282.2`	WHD_ROQ1	1349	1418	6.9e-27	94.1
LXL04_010616	`PF23598.2`	LRR_14	1673	1746	8.3e-65	219.6
LXL04_010616	`PF23598.2`	LRR_14	1738	1818	8.3e-65	219.6
LXL04_010616	`PF23598.2`	LRR_14	1825	1882	8.3e-65	219.6
LXL04_010616	`PF23598.2`	LRR_14	1874	1929	8.3e-65	219.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FI14`	Arabidopsis thaliana	Disease resistance protein TAO1	31.173%	Swiss-Prot	weak database homology
`Q9SZ66`	Arabidopsis thaliana	Disease resistance-like protein DSC1	31.377%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card