LXL04_010574 | RubberDandelionOmics

Gene overview

LXL04_010574

Reference: OH-1004 Chr: Chr02 Coordinates: 149280049-149285229 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4542 bp · LXL04_010574|LXL04_010574|OH1004|cDNA

ATGTCCGTCAATCAATCAAAGGGTAATAACAACGAGCCGCAGCAGTACAGAAGATCTGGTCGATCTGTTAACCCCGCCTCGCAGAAGAACTTttcaggtggtggtggtgggaaGGGCGGCGGCGGCGGCAGTACCACCGCCCCTCCCTCCTCTTCGTTTAATTCCGGTAAAAGCTTCAAGAAGGTGGTTAGTAATGCCCAAGGTACACAAACTAGGGTAACCGGTCAGAACCAGAGTGTTAATCCGAGTCCTTCAAATGC...

CDS

Download CDS FASTA

4542 bp · LXL04_010574|LXL04_010574|OH1004|CDS

ATGTCCGTCAATCAATCAAAGGGTAATAACAACGAGCCGCAGCAGTACAGAAGATCTGGTCGATCTGTTAACCCCGCCTCGCAGAAGAACTTTTCAGGTGGTGGTGGTGGGAAGGGCGGCGGCGGCGGCAGTACCACCGCCCCTCCCTCCTCTTCGTTTAATTCCGGTAAAAGCTTCAAGAAGGTGGTTAGTAATGCCCAAGGTACACAAACTAGGGTAACCGGTCAGAACCAGAGTGTTAATCCGAGTCCTTCAAATGC...

Protein

Download Protein FASTA

1513 aa · LXL04_010574|LXL04_010574|OH1004|PROTEIN

MSVNQSKGNNNEPQQYRRSGRSVNPASQKNFSGGGGGKGGGGGSTTAPPSSSFNSGKSFKKVVSNAQGTQTRVTGQNQSVNPSPSNASTVGRTVQNGAHIQPPLSGTPEATSSVQKSTPGLPKAPQSTAVSSGSTSITGPATPVKGSADASKAFSLQFGSISPGVMNGMQVPARTNSAPPNMDEQKRAQARLESLKPTTYQNPPVPKPRKDASTVDQSNPSEPHPPPKEKRDVIPSTTPIKPSGSPMPSIPNVLMQIPFH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010574`
TK1151 ID	TkA03G536060
OH-1004 ID	LXL04_010574
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	96.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010574

Location Chr02:149280049-149285229 (+)

Description Similar to Os07g0555200: Eukaryotic translation initiation factor 4G

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60240`	Component of the protein complex eIF4F, which is involved in the recognition of the mRNA cap, ATP-dependent unwinding of 5'-terminal secondary structure and recruitment of mRNA to the ribosome.	The Arabidopsis cucumovirus multiplication 1 and 2 loci encode translation initiation factors 4E and 4G.2004 · DOI: 10.1128/jvi.78.12.6102-6111.2004 Coordinated and selective recruitment of eIF4E and eIF4G factors for potyvirus infection in Arabidopsis thaliana.2007 · DOI: 10.1016/j.febslet.2007.02.007

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0555200`	Component of the protein complex eIF4F, which is involved in the recognition of the mRNA cap, ATP-dependent unwinding of 5'-terminal secondary structure and recruitment of mRNA to the ribosome.	No verified direct reference in this release
`Os02g0611500`	Plays a role in the accumulation of a sobemovirus (RYMV) during viral infection.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010574 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006413 translational initiation Biological Process

GO:0006417 regulation of translation Biological Process

GO:0016281 eukaryotic translation initiation factor 4F complex Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0003743 translation initiation factor activity Molecular Function

KEGG gene cross-reference

cmo:103496918

dosa:Os07g0555200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.752

Rank 1 · LXL04_010574 · OH-1004

Nucleus0.219

Rank 2 · LXL04_010574 · OH-1004

Cell membrane0.115

Rank 3 · LXL04_010574 · OH-1004

Golgi apparatus0.079

Rank 4 · LXL04_010574 · OH-1004

Endoplasmic reticulum0.044

Rank 5 · LXL04_010574 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02854.26MIF4G920-1145 aa

PF02847.24MA31333-1439 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010574	`PF02854.26`	MIF4G	920	1145	9.5e-53	179.7
LXL04_010574	`PF02847.24`	MA3	1333	1439	1.7e-14	54.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q76E23`	Arabidopsis thaliana	Eukaryotic translation initiation factor 4G	52.067%	Swiss-Prot	moderate database homology
`B9FXV5`	Oryza sativa subsp. japonica	Eukaryotic translation initiation factor 4G	55.556%	Swiss-Prot	moderate database homology
`Q6K641`	Oryza sativa subsp. japonica	Eukaryotic translation initiation factor isoform 4G-2	32.895%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card