LXL04_010535 | RubberDandelionOmics

Gene overview

LXL04_010535

Reference: OH-1004 Chr: Chr02 Coordinates: 148626771-148628231 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1245 bp · LXL04_010535|LXL04_010535|OH1004|cDNA

ATGCTAGATAATTCAGATATGTTTGAAGCAAGTGGTTGCTTTGATCCAAATTCTGTAACTCACCATCAACAAGTTCTTATTGATCATCAAGGTGACAGTTTCCATCAAATGCCCAATTTCTCCTCCATTGAAGCACCTGCAGATCAGCTTCATCACCAACATCTCATGAACATGGACATGGATCACCAAAACCACCAACAAATCAATTGGTCTCATAATCCTCATGATCAGATACTTATGGGGAATGATAACAATTGTTT...

CDS

Download CDS FASTA

1245 bp · LXL04_010535|LXL04_010535|OH1004|CDS

ATGCTAGATAATTCAGATATGTTTGAAGCAAGTGGTTGCTTTGATCCAAATTCTGTAACTCACCATCAACAAGTTCTTATTGATCATCAAGGTGACAGTTTCCATCAAATGCCCAATTTCTCCTCCATTGAAGCACCTGCAGATCAGCTTCATCACCAACATCTCATGAACATGGACATGGATCACCAAAACCACCAACAAATCAATTGGTCTCATAATCCTCATGATCAGATACTTATGGGGAATGATAACAATTGTTT...

Protein

Download Protein FASTA

414 aa · LXL04_010535|LXL04_010535|OH1004|PROTEIN

MLDNSDMFEASGCFDPNSVTHHQQVLIDHQGDSFHQMPNFSSIEAPADQLHHQHLMNMDMDHQNHQQINWSHNPHDQILMGNDNNCFPTPTPPDLLNLFQLPRCSSSICFSNPTHIDQNSGQVMYDPLLPHNLPPQPPFFRELLNSLPNGFNLTGCGSIFGEMDMERGEQNQLYHDGDAVLEFGGGIINGKGRDNKDTKHFATEKHRRQQLNGKFEALKGLVPNPTKADRASVVGDAIDYINELKRTVEELKILVERKRC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010535`
TK1151 ID	TkA03G534360
OH-1004 ID	LXL04_010535
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010535

Location Chr02:148626771-148628231 (+)

Description Similar to BHLH91: Transcription factor bHLH91

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g31210`	Transcription factor bHLH91.	No verified direct reference in this release
`At2g31220`	Transcription factor bHLH10.	No verified direct reference in this release
`At1g06170`	Transcription factor bHLH89.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0599300`	Transcription factor involved in the regulation of tapetum programmed cell death (PCD) and degradation during male reproductive development.	EAT1 promotes tapetal cell death by regulating aspartic proteases during male reproductive development in rice.2013 · DOI: 10.1038/ncomms2396
`Os01g0293100`	Transcription factor that binds to the E-box-containing promoter regions of the transcription factors TDR and EAT1, activating their expression.	The bHLH142 Transcription Factor Coordinates with TDR1 to Modulate the Expression of EAT1 and Regulate Pollen Development in Rice.2014 · DOI: 10.1105/tpc.114.126292

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010535 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009555 pollen development Biological Process

GO:0043068 positive regulation of programmed cell death Biological Process

GO:0048658 anther wall tapetum development Biological Process

GO:0052543 callose deposition in cell wall Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0046983 protein dimerization activity Molecular Function

GO:0070888 E-box binding Molecular Function

KEGG gene cross-reference

ath:AT1G06170

ath:AT2G31210

ath:AT2G31220

dosa:Os01g0293100

dosa:Os04g0599300

osa:4336865

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.977

Rank 1 · LXL04_010535 · OH-1004

Cytoplasm0.089

Rank 2 · LXL04_010535 · OH-1004

Cell membrane0.026

Rank 3 · LXL04_010535 · OH-1004

Endoplasmic reticulum0.021

Rank 4 · LXL04_010535 · OH-1004

Plastid0.012

Rank 5 · LXL04_010535 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010.32HLH198-245 aa

PF23177.2bHLH_IRO3202-269 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010535	`PF00010.32`	HLH	198	245	2.1e-11	44.2
LXL04_010535	`PF23177.2`	bHLH_IRO3	202	269	9.8e-07	29.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GX46`	Arabidopsis thaliana	Transcription factor bHLH91	42.494%	Swiss-Prot	moderate database homology
`Q84TK1`	Arabidopsis thaliana	Transcription factor bHLH10	45.501%	Swiss-Prot	moderate database homology
`Q9LND0`	Arabidopsis thaliana	Transcription factor bHLH89	40.899%	Swiss-Prot	moderate database homology
`Q7X8R0`	Oryza sativa subsp. japonica	Transcription factor EAT1	43.206%	Swiss-Prot	moderate database homology
`Q5JNS0`	Oryza sativa subsp. japonica	Transcription factor TIP2	45.000%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card