LXL04_010468 | RubberDandelionOmics

Gene overview

LXL04_010468

Reference: OH-1004 Chr: Chr02 Coordinates: 147194859-147197664 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1887 bp · LXL04_010468|LXL04_010468|OH1004|cDNA

ATGCCAACAATCAGTAATCTTTTCGCCGTGCTTTTCCTGTTGGTTTCAAACGCTTTTGTTTATGGAGTTTGTGACGGTTCTTCTCACTCAAGTCCCGGAACCAATGGTCAACTTCGTGCTCCCATTAGTGAACAACCACTCGCCAAAATCGCCCTTCACAAAGCTATTATTGCTCTCCATGCAACAGCCACCGTTCGTGTTAACCCTACAGTTTTGGGATCTAAGGGCGATGATACCGAATGGGTAAATGTAGACGTGGA...

CDS

Download CDS FASTA

1887 bp · LXL04_010468|LXL04_010468|OH1004|CDS

ATGCCAACAATCAGTAATCTTTTCGCCGTGCTTTTCCTGTTGGTTTCAAACGCTTTTGTTTATGGAGTTTGTGACGGTTCTTCTCACTCAAGTCCCGGAACCAATGGTCAACTTCGTGCTCCCATTAGTGAACAACCACTCGCCAAAATCGCCCTTCACAAAGCTATTATTGCTCTCCATGCAACAGCCACCGTTCGTGTTAACCCTACAGTTTTGGGATCTAAGGGCGATGATACCGAATGGGTAAATGTAGACGTGGA...

Protein

Download Protein FASTA

628 aa · LXL04_010468|LXL04_010468|OH1004|PROTEIN

MPTISNLFAVLFLLVSNAFVYGVCDGSSHSSPGTNGQLRAPISEQPLAKIALHKAIIALHATATVRVNPTVLGSKGDDTEWVNVDVDYPEAAQNDWVGVFSPAKFNSSESEYCSSETPFICTAPIKYKFANHSTFDYIQTGKASLSFQIINQRSDFAFALFTGGLETPKLVALSDPISFANPKAPLWPRLAQGKTWDEMTVTWTSGYGSDEATPVVEWGWKGRSELSPAGTLTFTRGSMCGPPARTIGWRAPGFIHTSSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010468`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010468

Location Chr02:147194859-147197664 (+)

Description Similar to PAP27: Probable inactive purple acid phosphatase 27

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g50400`	Probable inactive purple acid phosphatase 27.	No verified direct reference in this release
`At4g24890`	Probable inactive purple acid phosphatase 24.	No verified direct reference in this release
`At1g13750`	Probable inactive purple acid phosphatase 1.	No verified direct reference in this release
`At2g03450`	Probable inactive purple acid phosphatase 9.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010468 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0045037 protein import into chloroplast stroma Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009707 chloroplast outer membrane Cellular Component

GO:0003993 acid phosphatase activity Molecular Function

GO:0016787 hydrolase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G13750

ath:AT2G03450

ath:AT4G24890

ath:AT5G50400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.318

Rank 1 · LXL04_010468 · OH-1004

Extracellular0.270

Rank 2 · LXL04_010468 · OH-1004

Cell membrane0.153

Rank 3 · LXL04_010468 · OH-1004

Cytoplasm0.123

Rank 4 · LXL04_010468 · OH-1004

Endoplasmic reticulum0.105

Rank 5 · LXL04_010468 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17808.8fn3_PAP65-181 aa

PF16656.12Pur_ac_phosph_N189-291 aa

PF00149.34Metallophos303-518 aa

PF14008.12Metallophos_C543-602 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010468	`PF17808.8`	fn3_PAP	65	181	1.2e-40	138.9
LXL04_010468	`PF16656.12`	Pur_ac_phosph_N	189	291	5.4e-12	46.9
LXL04_010468	`PF00149.34`	Metallophos	303	518	5.2e-16	60.4
LXL04_010468	`PF14008.12`	Metallophos_C	543	602	5.1e-14	53.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5MAU8`	Arabidopsis thaliana	Probable inactive purple acid phosphatase 27	66.613%	Swiss-Prot	strong database homology
`Q8H1R2`	Arabidopsis thaliana	Probable inactive purple acid phosphatase 24	65.306%	Swiss-Prot	strong database homology
`Q9LMX4`	Arabidopsis thaliana	Probable inactive purple acid phosphatase 1	63.605%	Swiss-Prot	strong database homology
`Q9ZQ81`	Arabidopsis thaliana	Probable inactive purple acid phosphatase 9	28.571%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card