RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_010452
Reference: OH-1004 Chr: Chr02 Coordinates: 146838288-146851435 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

5245 bp · LXL04_010452|LXL04_010452|OH1004|cDNA

ATAACAGTTTCTATTTGTTATACTATCATTCCAATAATAAGAACAATATTACTCTTTTTTTTTGCAGTATAATGAATATGGAACAAAAGAAAGCATTTTACTTTTTGAGAGCTGTTTCCATCACTTCAAGATTTATAAAAAAGGCTTAAAGAGTTTGCATCTAGAACCCCCAGTTGCTTCACTCTTCAAAAAGCTAATGGAAAAGCCTCATTTCTGTAAGGTGTTCACTGGTTTAGTTGAAAATACAAACACAACAATCA...

CDS

Download CDS FASTA

5184 bp · LXL04_010452|LXL04_010452|OH1004|CDS

TTGCAGTATAATGAATATGGAACAAAAGAAAGCATTTTACTTTTTGAGAGCTGTTTCCATCACTTCAAGATTTATAAAAAAGGCTTAAAGAGTTTGCATCTAGAACCCCCAGTTGCTTCACTCTTCAAAAAGCTAATGGAAAAGCCTCATTTCTGTAAGGTGTTCACTGGTTTAGTTGAAAATACAAACACAACAATCAATGAAGAATTCCTGGATGATCTATCAACCGCACTGAAACTATCACCATTTGAGAAACTTGG...

Protein

Download Protein FASTA

1727 aa · LXL04_010452|LXL04_010452|OH1004|PROTEIN

MQYNEYGTKESILLFESCFHHFKIYKKGLKSLHLEPPVASLFKKLMEKPHFCKVFTGLVENTNTTINEEFLDDLSTALKLSPFEKLGFGFALSNSENNNVRIAGRNFCMAQLKELCINLKTPQNLIQHEISSTVLPLLLKDAEMSEPVLDLWNANPPFFSRALNALLTLNPENMHKIVELLQESEVFQEQTALLSQLSKEMERLQITYTDNSPIIENISDPDTSAFEEVDNIEAEANAYFQQMFSGELTIGAMVQMLMRF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_010452
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_010452
LocationChr02:146838288-146851435 (+)
DescriptionSimilar to cnot1: CCR4-NOT transcription complex subunit 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_010452 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process
GO:0000288 nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay Biological Process
GO:0000289 nuclear-transcribed mRNA poly(A) tail shortening Biological Process
GO:0006351 DNA-templated transcription Biological Process
GO:0010606 positive regulation of cytoplasmic mRNA processing body assembly Biological Process
GO:0017148 negative regulation of translation Biological Process
GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process
GO:0033147 negative regulation of intracellular estrogen receptor signaling pathway Biological Process
GO:0035195 miRNA-mediated post-transcriptional gene silencing Biological Process
GO:0048387 negative regulation of retinoic acid receptor signaling pathway Biological Process
GO:0060213 positive regulation of nuclear-transcribed mRNA poly(A) tail shortening Biological Process
GO:0061014 positive regulation of mRNA catabolic process Biological Process
KEGG gene cross-reference
hsa:23019
mmu:234594
xtr:100036630
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.519
Rank 1 · LXL04_010452 · OH-1004
Nucleus0.415
Rank 2 · LXL04_010452 · OH-1004
Cell membrane0.070
Rank 3 · LXL04_010452 · OH-1004
Golgi apparatus0.063
Rank 4 · LXL04_010452 · OH-1004
Lysosome / Vacuole0.057
Rank 5 · LXL04_010452 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16417.12CNOT1_TTP_bind213-383 aa
PF16415.12CNOT1_CAF1_bind526-728 aa
PF12842.13DUF3819775-915 aa
PF25097.2ARM_Cnot1999-1154 aa
PF23590.2NOT1_connector1040-1153 aa
PF04054.22Not11354-1721 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_010452PF16417.12CNOT1_TTP_bind2133832.3e-46158.1
LXL04_010452PF16415.12CNOT1_CAF1_bind5267282.3e-68230.6
LXL04_010452PF12842.13DUF38197759152.9e-31109.2
LXL04_010452PF25097.2ARM_Cnot199911542e-30106.7
LXL04_010452PF23590.2NOT1_connector104011532.3e-0731.2
LXL04_010452PF04054.22Not1135417214.7e-125418.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser