LXL04_010364 | RubberDandelionOmics

Gene overview

LXL04_010364

Reference: OH-1004 Chr: Chr02 Coordinates: 145237032-145238707 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1599 bp · LXL04_010364|LXL04_010364|OH1004|cDNA

ATGGAAGAAGAGGACACCAAATCGACCATCAATACCAACATCGAAGATGACAATACCCAAATCTACGAAGAATCCCTCTTTGTCGATTCCTCGGACGCTTTTGATTCCGATCAACCCCTTTCCATCGCCAAACCTTCATCGATCTCCGACCTTTATAACATCAATGTTGACAGTCCAACCCAATCAGAAGAAGCGCCAGCATCTTCTTCATCCTCTGATCTCTACCACACGCCACTTGATTCCGAACAGAGTTCGAAAGA...

CDS

Download CDS FASTA

1599 bp · LXL04_010364|LXL04_010364|OH1004|CDS

ATGGAAGAAGAGGACACCAAATCGACCATCAATACCAACATCGAAGATGACAATACCCAAATCTACGAAGAATCCCTCTTTGTCGATTCCTCGGACGCTTTTGATTCCGATCAACCCCTTTCCATCGCCAAACCTTCATCGATCTCCGACCTTTATAACATCAATGTTGACAGTCCAACCCAATCAGAAGAAGCGCCAGCATCTTCTTCATCCTCTGATCTCTACCACACGCCACTTGATTCCGAACAGAGTTCGAAAGA...

Protein

Download Protein FASTA

532 aa · LXL04_010364|LXL04_010364|OH1004|PROTEIN

MEEEDTKSTINTNIEDDNTQIYEESLFVDSSDAFDSDQPLSIAKPSSISDLYNINVDSPTQSEEAPASSSSSDLYHTPLDSEQSSKEISVFHSFKKPDGSVDFPMGDCKSSYSMKDKEKSKTKLNSARRRASSISHPKSLNEDTSASSAITSVSTDERIDDDSITADSPVSGSNFLYSLAGLVIKMIGFQLHLLATSVTFPVSVIYYSYLFVLDPFRITSRAKYYILGNISKIISLCFNSFKSTIITWIKKHESTWKLCG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010364`
TK1151 ID	TkA03G522660
OH-1004 ID	LXL04_010364
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010364

Location Chr02:145237032-145238707 (+)

Description Similar to SEI2: Seipin-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29760`	Involved in lipid metabolism and lipid droplet (LD) morphology, number, and size.	No verified direct reference in this release
`At2g34380`	Involved in lipid metabolism and lipid droplet (LD) morphology, number, and size.	No verified direct reference in this release
`At5g16460`	Involved in lipid metabolism and lipid droplet (LD) morphology, number, and size.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010364 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006629 lipid metabolic process Biological Process

GO:0009846 pollen germination Biological Process

GO:0010162 seed dormancy process Biological Process

GO:0010344 seed oilbody biogenesis Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0019915 lipid storage Biological Process

GO:0034389 lipid droplet organization Biological Process

GO:0043086 negative regulation of catalytic activity Biological Process

GO:0048316 seed development Biological Process

GO:0048515 spermatid differentiation Biological Process

GO:0050995 negative regulation of lipid catabolic process Biological Process

GO:0061725 cytosolic lipolysis Biological Process

KEGG gene cross-reference

ath:AT1G29760

ath:AT2G34380

ath:AT5G16460

bta:513558

rno:361722

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.615

Rank 1 · LXL04_010364 · OH-1004

Nucleus0.231

Rank 2 · LXL04_010364 · OH-1004

Golgi apparatus0.151

Rank 3 · LXL04_010364 · OH-1004

Cytoplasm0.100

Rank 4 · LXL04_010364 · OH-1004

Cell membrane0.087

Rank 5 · LXL04_010364 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06775.20Seipin278-495 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010364	`PF06775.20`	Seipin	278	495	7.3e-52	176.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I340`	Arabidopsis thaliana	Seipin-2	39.089%	Swiss-Prot	moderate database homology
`Q8L615`	Arabidopsis thaliana	Seipin-3	45.330%	Swiss-Prot	moderate database homology
`Q9FFD9`	Arabidopsis thaliana	Seipin-1	30.827%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card