LXL04_010327 | RubberDandelionOmics

Gene overview

LXL04_010327

Reference: OH-1004 Chr: Chr02 Coordinates: 144301553-144302653 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1029 bp · LXL04_010327|LXL04_010327|OH1004|cDNA

ATGGCTACATCTGTAAAAAGAGCACTTATTATCGCCTCTATCCTTGCCATAGGGATACTGTGGTCTTCAGGGGTTACATGCCGCATGTTAGGTGATCATGACCTACCCATGTCAACAAGGCATGAGTTGTGGATGGTACGTTACGCACGTGTGTACAACAATGACTCGGAGAAGGAAATGCGGTTCAACATATTCAAGGAGAACGTTGAATTCATAGAATCATTCAACAGAGCTGAAAACCAGCCTTACAAACTTGCGGT...

CDS

Download CDS FASTA

1029 bp · LXL04_010327|LXL04_010327|OH1004|CDS

ATGGCTACATCTGTAAAAAGAGCACTTATTATCGCCTCTATCCTTGCCATAGGGATACTGTGGTCTTCAGGGGTTACATGCCGCATGTTAGGTGATCATGACCTACCCATGTCAACAAGGCATGAGTTGTGGATGGTACGTTACGCACGTGTGTACAACAATGACTCGGAGAAGGAAATGCGGTTCAACATATTCAAGGAGAACGTTGAATTCATAGAATCATTCAACAGAGCTGAAAACCAGCCTTACAAACTTGCGGT...

Protein

Download Protein FASTA

342 aa · LXL04_010327|LXL04_010327|OH1004|PROTEIN

MATSVKRALIIASILAIGILWSSGVTCRMLGDHDLPMSTRHELWMVRYARVYNNDSEKEMRFNIFKENVEFIESFNRAENQPYKLAVNEFADQTNKEFKSTRNGYKSSSNKRTTPFRYENETAVPPTMDWRKKGAVTPVKDQGQCGSCWAFSTIAATEGITQLTTGKLISLSEQELVDCDRSGEDQGCNGGEMEDGFEFIVKNKGINTEVAYPYQAADGTCNTNKESGHAASITGYEKVPANSETALLQAVANQPVSVSI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010327`
TK1151 ID	TkA03G519520
OH-1004 ID	LXL04_010327
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	95.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010327

Location Chr02:144301553-144302653 (+)

Description Similar to OsI_14861: Senescence-specific cysteine protease SAG39

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XQE8`	Cysteine protease that may have a developmental senescence specific cell death function during apoptosis, heavy metal detoxification, and hypersensitive response.	No verified direct reference in this release
`Os04g0206300`	Cysteine protease that may have a developmental senescence specific cell death function during apoptosis, heavy metal detoxification, and hypersensitive response.	No verified direct reference in this release
`Os11g0255300`	Cysteine endopeptidase that digests in vitro both the acidic and basic subunits of glutelin, the major seed storage protein of rice.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010327 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010623 programmed cell death involved in cell development Biological Process

GO:0051603 proteolysis involved in protein catabolic process Biological Process

GO:0000326 protein storage vacuole Cellular Component

GO:0005615 extracellular space Cellular Component

GO:0005764 lysosome Cellular Component

GO:0005788 endoplasmic reticulum lumen Cellular Component

GO:0010282 senescence-associated vacuole Cellular Component

KEGG gene cross-reference

dosa:Os11g0255300

osa:107276017

osa:4350216

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.633

Rank 1 · LXL04_010327 · OH-1004

Extracellular0.202

Rank 2 · LXL04_010327 · OH-1004

Cytoplasm0.180

Rank 3 · LXL04_010327 · OH-1004

Endoplasmic reticulum0.114

Rank 4 · LXL04_010327 · OH-1004

Cell membrane0.105

Rank 5 · LXL04_010327 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08246.18Inhibitor_I2941-98 aa

PF00112.30Peptidase_C1124-341 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010327	`PF08246.18`	Inhibitor_I29	41	98	1.6e-17	64.3
LXL04_010327	`PF00112.30`	Peptidase_C1	124	341	1.1e-81	274.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A2XQE8`	Oryza sativa subsp. indica	Senescence-specific cysteine protease SAG39	58.017%	Swiss-Prot	strong database homology
`Q7XWK5`	Oryza sativa subsp. japonica	Senescence-specific cysteine protease SAG39	58.017%	Swiss-Prot	strong database homology
`Q7GDU7`	Oryza sativa subsp. japonica	Cysteine endopeptidase RepA	54.688%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card