LXL04_010314 | RubberDandelionOmics

Gene overview

LXL04_010314

Reference: OH-1004 Chr: Chr02 Coordinates: 144059491-144074689 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2415 bp · LXL04_010314|LXL04_010314|OH1004|cDNA

ATGGCGAATTCGTTAACTTTCGTCCCCATTTTATTGCTGTTATTGTCTTCATGTAACGTGTATACTAATGCATGTTATCCGTCAATCATAAGCTTCGGCGATTCACTTGCAGATACTGGAAATGCGAAAGAAATCGCCACTAAATCCAACATTCAGGCACCCCATTTCTTATTTCCACCTTATGGCGAAACGTTTTTCAATAAACCCACCGGACGTTGTTCTAACGGCCGTTTAATCATTGATTTCGTTGCTGAAAGTTT...

CDS

Download CDS FASTA

2415 bp · LXL04_010314|LXL04_010314|OH1004|CDS

ATGGCGAATTCGTTAACTTTCGTCCCCATTTTATTGCTGTTATTGTCTTCATGTAACGTGTATACTAATGCATGTTATCCGTCAATCATAAGCTTCGGCGATTCACTTGCAGATACTGGAAATGCGAAAGAAATCGCCACTAAATCCAACATTCAGGCACCCCATTTCTTATTTCCACCTTATGGCGAAACGTTTTTCAATAAACCCACCGGACGTTGTTCTAACGGCCGTTTAATCATTGATTTCGTTGCTGAAAGTTT...

Protein

Download Protein FASTA

804 aa · LXL04_010314|LXL04_010314|OH1004|PROTEIN

MANSLTFVPILLLLLSSCNVYTNACYPSIISFGDSLADTGNAKEIATKSNIQAPHFLFPPYGETFFNKPTGRCSNGRLIIDFVAESFGLPLIPPSLGGKMNVDVTEVGQGVNYAVAGATALDASFHEARGVDIWTNASLGVQLGWFKDSLSSVCSAVLDCKRLIGESLVLMGEIGGNDYNHALVAGKSIDEVKTYVPLVINTLVSAVNELIELGAQTLVIPGNLPIGCSAAYLTIFYGSDNVEYDNSTGCIITLNKLAEY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010314`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010314

Location Chr02:144059491-144074689 (+)

Description Similar to At1g28600: GDSL esterase/lipase At1g28600

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g28600`	GDSL esterase/lipase At1g28600.	No verified direct reference in this release
`At1g28580`	GDSL esterase/lipase At1g28580.	No verified direct reference in this release
`At1g28590`	GDSL esterase/lipase At1g28590.	No verified direct reference in this release
`At1g28570`	GDSL esterase/lipase At1g28570.	No verified direct reference in this release
`At1g31550`	GDSL esterase/lipase At1g31550.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010314 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005976 polysaccharide metabolic process Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016788 hydrolase activity, acting on ester bonds Molecular Function

GO:0046555 acetylxylan esterase activity Molecular Function

KEGG gene cross-reference

ath:AT1G28580

ath:AT1G28590

ath:AT1G28600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.316

Rank 1 · LXL04_010314 · OH-1004

Lysosome / Vacuole0.268

Rank 2 · LXL04_010314 · OH-1004

Cytoplasm0.154

Rank 3 · LXL04_010314 · OH-1004

Endoplasmic reticulum0.135

Rank 4 · LXL04_010314 · OH-1004

Cell membrane0.115

Rank 5 · LXL04_010314 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00657.29Lipase_GDSL29-358 aa

PF00657.29Lipase_GDSL444-773 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010314	`PF00657.29`	Lipase_GDSL	29	358	2.2e-59	201.8
LXL04_010314	`PF00657.29`	Lipase_GDSL	444	773	2.2e-59	201.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94F40`	Arabidopsis thaliana	GDSL esterase/lipase At1g28600	49.591%	Swiss-Prot	weak database homology
`Q9FXJ2`	Arabidopsis thaliana	GDSL esterase/lipase At1g28580	48.462%	Swiss-Prot	weak database homology
`Q8RXT9`	Arabidopsis thaliana	GDSL esterase/lipase At1g28590	53.209%	Swiss-Prot	weak database homology
`Q9FXJ1`	Arabidopsis thaliana	GDSL esterase/lipase At1g28570	48.556%	Swiss-Prot	weak database homology
`Q9C857`	Arabidopsis thaliana	GDSL esterase/lipase At1g31550	50.843%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card