Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1098 bp · LXL04_010217|LXL04_010217|OH1004|cDNA
ATGGACCAAATAGAGCACAAGTACGTTGAAGTGAACGGGATCAAGCTTCATGTTGCCGAGATCGGAAAAGAGTCGTCGCCGGCAGTGGTTTTCTTGCATGGTTTCCCGGAGATATGGTACACCTGGCGCCACCAGATGATTGGCGTCGCCAATGCTGGTTTCAGAGCCATTGCACCTGATTTCAGAGGTTACGGGCTATCAGATCATGGCGTTGAACCGGACAAAACTTCCTTTTCCGATATGCTTTATGATACTGTCGC...
1098 bp · LXL04_010217|LXL04_010217|OH1004|CDS
ATGGACCAAATAGAGCACAAGTACGTTGAAGTGAACGGGATCAAGCTTCATGTTGCCGAGATCGGAAAAGAGTCGTCGCCGGCAGTGGTTTTCTTGCATGGTTTCCCGGAGATATGGTACACCTGGCGCCACCAGATGATTGGCGTCGCCAATGCTGGTTTCAGAGCCATTGCACCTGATTTCAGAGGTTACGGGCTATCAGATCATGGCGTTGAACCGGACAAAACTTCCTTTTCCGATATGCTTTATGATACTGTCGC...
Protein
Download Protein FASTA365 aa · LXL04_010217|LXL04_010217|OH1004|PROTEIN
MDQIEHKYVEVNGIKLHVAEIGKESSPAVVFLHGFPEIWYTWRHQMIGVANAGFRAIAPDFRGYGLSDHGVEPDKTSFSDMLYDTVAILDFLNISKVFVIGKDFGAFVAYAFALLYRERVLGVVTLGVPFIPPGPLVSHETLPEGFYISRFRDPGRAEADFSRFDAKTVVKNIYILFSGSEIPIASKNQEIMDLVESDTPLPSWFTEDDLTAYGNLYEKSGFRTSLKVPYRSLLDERYEFKIEDPKVEGRALLIMGEKDY...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_010217 |
|---|---|
| TK1151 ID | TkA03G512110 |
| OH-1004 ID | LXL04_010217 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 99.200 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 67.397Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_010217 |
|---|---|
| Location | Chr02:142366779-142368506 (+) |
| Description | Similar to Ephx2: Bifunctional epoxide hydrolase 2 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0001558 regulation of cell growth Biological Process GO:0009636 response to toxic substance Biological Process GO:0010628 positive regulation of gene expression Biological Process GO:0016311 dephosphorylation Biological Process GO:0042632 cholesterol homeostasis Biological Process GO:0043651 linoleic acid metabolic process Biological Process GO:0045777 positive regulation of blood pressure Biological Process GO:0046272 stilbene catabolic process Biological Process GO:0046839 phospholipid dephosphorylation Biological Process GO:0090181 regulation of cholesterol metabolic process Biological Process GO:0097176 epoxide metabolic process Biological Process GO:0005777 peroxisome Cellular Component |
| KEGG gene cross-reference | hsa:2053 mmu:13850 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF12146.16Hydrolase_426-127 aaPF00561.27Abhydrolase_127-298 aaPF12697.14Abhydrolase_629-305 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_010217 | PF12146.16 | Hydrolase_4 | 26 | 127 | 3.1e-10 | 40.5 |
| LXL04_010217 | PF00561.27 | Abhydrolase_1 | 27 | 298 | 2.2e-24 | 87.2 |
| LXL04_010217 | PF12697.14 | Abhydrolase_6 | 29 | 305 | 2.2e-15 | 58.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.