Gene Card
Gene overview
cDNA / CDS / Protein Sequences
588 bp · LXL04_010196|LXL04_010196|OH1004|cDNA
ATGCAACGTTTAATTGCGTCAACCGAGAGTGTCTTCCCTCATCTCCTCCGGTACCAAAAACCACCTACTGCCGTCATGGTAAAACGTCAGCAGCCACCTTGCGATGTTTTCATTAACCATCGTGGAATCGACACAAAGAAGAATGTCGCCGGACTTTTGTATAATCATCTCAAGAGGTTAACATTAAGGCCTTTCTTGGACAGCAAGAACATGAAACCAGGGGATAAGTTGTTCGATAAAATTGACTCTGCAATCAGCGG...
588 bp · LXL04_010196|LXL04_010196|OH1004|CDS
ATGCAACGTTTAATTGCGTCAACCGAGAGTGTCTTCCCTCATCTCCTCCGGTACCAAAAACCACCTACTGCCGTCATGGTAAAACGTCAGCAGCCACCTTGCGATGTTTTCATTAACCATCGTGGAATCGACACAAAGAAGAATGTCGCCGGACTTTTGTATAATCATCTCAAGAGGTTAACATTAAGGCCTTTCTTGGACAGCAAGAACATGAAACCAGGGGATAAGTTGTTCGATAAAATTGACTCTGCAATCAGCGG...
Protein
Download Protein FASTA195 aa · LXL04_010196|LXL04_010196|OH1004|PROTEIN
MQRLIASTESVFPHLLRYQKPPTAVMVKRQQPPCDVFINHRGIDTKKNVAGLLYNHLKRLTLRPFLDSKNMKPGDKLFDKIDSAISGCKVSVAVFSPRYCQSYFCLHELARIMEARKKVIPVFCDVKPSELVVKNDWRCPKHELVRFQSALEEAKYTVGLTFDSSKGDWPGFLMTATEAIIENLIEVEEEEHRRC
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_010196 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_010196 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:141812474-141813758 (-) | |||||||||
| Description | Similar to BRADI_1g24377v3: TIR-only protein | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006952 defense response Biological Process GO:0007165 signal transduction Biological Process GO:0009416 response to light stimulus Biological Process GO:0009626 plant-type hypersensitive response Biological Process GO:0010114 response to red light Biological Process GO:0019677 NAD+ catabolic process Biological Process GO:0042742 defense response to bacterium Biological Process GO:0043068 positive regulation of programmed cell death Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0009506 plasmodesma Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G72930 ath:AT5G17880 bdi:100831488 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01582.26TIR35-130 aaPF13676.12TIR_236-128 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_010196 | PF01582.26 | TIR | 35 | 130 | 5.1e-19 | 69.5 |
| LXL04_010196 | PF13676.12 | TIR_2 | 36 | 128 | 1.8e-17 | 64.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.