LXL04_010186 | RubberDandelionOmics

Gene overview

LXL04_010186

Reference: OH-1004 Chr: Chr02 Coordinates: 141614351-141619059 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3549 bp · LXL04_010186|LXL04_010186|OH1004|cDNA

ATGATGATGACAAACGGTGATACCTCCTACCAATGGcttgatgatgatgatgatgcagATTTAGTTGGGGATGATGGTGCGCTGAGCATGGACATTGAATCGTTTTTAAGTATTCTTGACGAGAGTCCTCCCGATGAGCCTttgcagAGTGGATTGGTGGATCCTTCCTTAAGTATTGCACTCTCTAATGAGCCAGCTTCAAATGTTGCTGCAAACGACCAATCCCAAATCCATGATGATCACTCAGATGCTTCAGCTTC...

CDS

Download CDS FASTA

3549 bp · LXL04_010186|LXL04_010186|OH1004|CDS

ATGATGATGACAAACGGTGATACCTCCTACCAATGGCTTGATGATGATGATGATGCAGATTTAGTTGGGGATGATGGTGCGCTGAGCATGGACATTGAATCGTTTTTAAGTATTCTTGACGAGAGTCCTCCCGATGAGCCTTTGCAGAGTGGATTGGTGGATCCTTCCTTAAGTATTGCACTCTCTAATGAGCCAGCTTCAAATGTTGCTGCAAACGACCAATCCCAAATCCATGATGATCACTCAGATGCTTCAGCTTC...

Protein

Download Protein FASTA

1182 aa · LXL04_010186|LXL04_010186|OH1004|PROTEIN

MMMTNGDTSYQWLDDDDDADLVGDDGALSMDIESFLSILDESPPDEPLQSGLVDPSLSIALSNEPASNVAANDQSQIHDDHSDASASKTVCSDGSSDYERQTVNYGLTKMGPVSAVSSMHNSWSPANWTVPIPPGDFSSSSHYNNRETNPERATKDGTFVNTYDNHNGSHQSMDTSSIPDFADFCSTSEAPFMNVGGYSSDFHCNPDDESSMPLLYAINRNDTPMIYNNGMMFNDKIASNGYQNSGIPQYISSKGNTSIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010186`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010186

Location Chr02:141614351-141619059 (+)

Description Similar to CHR28: Helicase-like transcription factor CHR28

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g50410`	Probable helicase-like transcription factor involved in transcriptional gene silencing.	SUVR2 is involved in transcriptional gene silencing by associating with SNF2-related chromatin-remodeling proteins in Arabidopsis.2014 · DOI: 10.1038/cr.2014.156 SNF2 chromatin remodeler-family proteins FRG1 and -2 are required for RNA-directed DNA methylation.2014 · DOI: 10.1073/pnas.1420515111
`At3g20010`	Probable helicase-like transcription factor involved in transcriptional gene silencing.	SUVR2 is involved in transcriptional gene silencing by associating with SNF2-related chromatin-remodeling proteins in Arabidopsis.2014 · DOI: 10.1038/cr.2014.156 SNF2 chromatin remodeler-family proteins FRG1 and -2 are required for RNA-directed DNA methylation.2014 · DOI: 10.1073/pnas.1420515111
`At5g22750`	Functions in error-free postreplication DNA repair or DNA- damage tolerance (DTT) pathway.	A homolog of ScRAD5 is involved in DNA repair and homologous recombination in Arabidopsis.2008 · DOI: 10.1104/pp.108.116806 RAD5A, RECQ4A, and MUS81 have specific functions in homologous recombination and define different pathways of DNA repair in Arabidopsis thaliana.2010 · DOI: 10.1105/tpc.110.078568 RAD5a and REV3 function in two alternative pathways of DNA-damage tolerance in Arabidopsis.2011 · DOI: 10.1016/j.dnarep.2011.04.009 AtRAD5A is a DNA translocase harboring a HIRAN domain which confers binding to branched DNA structures and is required for DNA repair in vivo.2016 · DOI: 10.1111/tpj.13283
`At5g43530`	Possesses intrinsic ATP-dependent nucleosome-remodeling activity.	A homolog of ScRAD5 is involved in DNA repair and homologous recombination in Arabidopsis.2008 · DOI: 10.1104/pp.108.116806

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010186 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006281 DNA repair Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009294 DNA-mediated transformation Biological Process

GO:0032435 negative regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0036297 interstrand cross-link repair Biological Process

GO:0045003 double-strand break repair via synthesis-dependent strand annealing Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G50410

ath:AT3G20010

ath:AT5G22750

ath:AT5G43530

spo:2540464

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.924

Rank 1 · LXL04_010186 · OH-1004

Cytoplasm0.132

Rank 2 · LXL04_010186 · OH-1004

Mitochondrion0.024

Rank 3 · LXL04_010186 · OH-1004

Cell membrane0.022

Rank 4 · LXL04_010186 · OH-1004

Plastid0.016

Rank 5 · LXL04_010186 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00176.30SNF2-rel_dom447-851 aa

PF00097.32zf-C3HC4892-928 aa

PF13923.13zf-C3HC4_2892-928 aa

PF00271.38Helicase_C1026-1123 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010186	`PF00176.30`	SNF2-rel_dom	447	851	2.1e-66	224.7
LXL04_010186	`PF00097.32`	zf-C3HC4	892	928	3.6e-08	33.9
LXL04_010186	`PF13923.13`	zf-C3HC4_2	892	928	4e-07	30.4
LXL04_010186	`PF00271.38`	Helicase_C	1026	1123	1.6e-19	70.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BR5`	Arabidopsis thaliana	Helicase-like transcription factor CHR28	56.863%	Swiss-Prot	moderate database homology
`Q9LHE4`	Arabidopsis thaliana	Helicase-like transcription factor CHR27	54.600%	Swiss-Prot	moderate database homology
`Q9FNI6`	Arabidopsis thaliana	DNA repair protein RAD5A	32.345%	Swiss-Prot	moderate database homology
`Q9FIY7`	Arabidopsis thaliana	DNA repair protein RAD5B	31.629%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card