LXL04_010125 | RubberDandelionOmics

Gene overview

LXL04_010125

Reference: OH-1004 Chr: Chr02 Coordinates: 140650908-140652436 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1011 bp · LXL04_010125|LXL04_010125|OH1004|cDNA

ATGGGAAGAACACCTTGCTGTGAAAAGAATGGTGGTTTGAGGAAAGGTCCATGGACTACTGAAGAAGATCAAAAACTCATTGATTACATTCACAAGAATGGCTATGGAAATTGGAGAACGCTACCCAAGAATGCTGgtttgcAAAGATGTGGAAAAAGTTGTAGGTTAAGATGGACGAATTATCTTAAGCCTGATATTAAAAGAGGCAAGTTTTCTACCGAGGAGGAAGAAACAATCATTCAACTTCATAGTGTCTTGGG...

CDS

Download CDS FASTA

1011 bp · LXL04_010125|LXL04_010125|OH1004|CDS

ATGGGAAGAACACCTTGCTGTGAAAAGAATGGTGGTTTGAGGAAAGGTCCATGGACTACTGAAGAAGATCAAAAACTCATTGATTACATTCACAAGAATGGCTATGGAAATTGGAGAACGCTACCCAAGAATGCTGGTTTGCAAAGATGTGGAAAAAGTTGTAGGTTAAGATGGACGAATTATCTTAAGCCTGATATTAAAAGAGGCAAGTTTTCTACCGAGGAGGAAGAAACAATCATTCAACTTCATAGTGTCTTGGG...

Protein

Download Protein FASTA

336 aa · LXL04_010125|LXL04_010125|OH1004|PROTEIN

MGRTPCCEKNGGLRKGPWTTEEDQKLIDYIHKNGYGNWRTLPKNAGLQRCGKSCRLRWTNYLKPDIKRGKFSTEEEETIIQLHSVLGNKWSTIAARLPGRTDNEIKNYWNTHIRKRLLRMGIDPITHNTRLDILALSSIMINSPDLYNSTMVNPELLRLMASISSQGNQNPYFIHQNPQKHILENTLQAQENHYLLQDQTLIQEISNCASLSTPTFVVPSSSETSKLMQPNVNQFPSSVSEFKPQTCHYIDVLTSNNLEN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010125`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010125

Location Chr02:140650908-140652436 (-)

Description Similar to MYB102: Transcription factor MYB102

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g21440`	Probable transcription factor that may function in osmotic stress and wounding signaling pathways (Probable).	Integration of wounding and osmotic stress signals determines the expression of the AtMYB102 transcription factor gene.2003 · DOI: 10.1104/pp.102.019273 The Arabidopsis thaliana Transcription Factor AtMYB102 Functions in Defense Against the Insect Herbivore Pieris rapae.2006 · DOI: 10.4161/psb.1.6.3512
`At4g05100`	Probable transcription factor that may function in salt stress response.	Salt-induced transcription factor MYB74 is regulated by the RNA-directed DNA methylation pathway in Arabidopsis.2015 · DOI: 10.1093/jxb/erv312
`At4g28110`	Transcription factor involved in salt stress response.	AtMyb41 regulates transcriptional and metabolic responses to osmotic stress in Arabidopsis.2009 · DOI: 10.1104/pp.108.134874 Phosphorylation by AtMPK6 is required for the biological function of AtMYB41 in Arabidopsis.2012 · DOI: 10.1016/j.bbrc.2012.04.137 AtMYB41 activates ectopic suberin synthesis and assembly in multiple plant species and cell types.2014 · DOI: 10.1111/tpj.12624
`At1g34670`	Transcription factor that acts as a negative regulator of lateral root (LR) development.	AtMYB93 is a novel negative regulator of lateral root development in Arabidopsis.2014 · DOI: 10.1111/nph.12879
`At4g17785`	Transcription factor MYB39.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010125 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009611 response to wounding Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0010345 suberin biosynthetic process Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0071365 cellular response to auxin stimulus Biological Process

KEGG gene cross-reference

ath:AT1G34670

ath:AT4G05100

ath:AT4G17785

ath:AT4G21440

ath:AT4G28110

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.811

Rank 1 · LXL04_010125 · OH-1004

Cytoplasm0.289

Rank 2 · LXL04_010125 · OH-1004

Mitochondrion0.026

Rank 3 · LXL04_010125 · OH-1004

Cell membrane0.020

Rank 4 · LXL04_010125 · OH-1004

Lysosome / Vacuole0.013

Rank 5 · LXL04_010125 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249.38Myb_DNA-binding15-62 aa

PF13921.13Myb_DNA-bind_618-78 aa

PF00249.38Myb_DNA-binding68-112 aa

PF13921.13Myb_DNA-bind_671-115 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010125	`PF00249.38`	Myb_DNA-binding	15	62	2.7e-36	124.2
LXL04_010125	`PF13921.13`	Myb_DNA-bind_6	18	78	1.3e-22	80.5
LXL04_010125	`PF00249.38`	Myb_DNA-binding	68	112	2.7e-36	124.2
LXL04_010125	`PF13921.13`	Myb_DNA-bind_6	71	115	1.3e-22	80.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LDR8`	Arabidopsis thaliana	Transcription factor MYB102	48.787%	Swiss-Prot	moderate database homology
`Q9M0Y5`	Arabidopsis thaliana	Transcription factor MYB74	62.871%	Swiss-Prot	moderate database homology
`Q9M0J5`	Arabidopsis thaliana	Transcription factor MYB41	67.956%	Swiss-Prot	moderate database homology
`Q9S9Z2`	Arabidopsis thaliana	Transcription factor MYB93	74.074%	Swiss-Prot	weak database homology
`Q8GWP0`	Arabidopsis thaliana	Transcription factor MYB39	46.102%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card