Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1080 bp · LXL04_009960|LXL04_009960|OH1004|cDNA
ATGTTCACTCTAAACAACCTATTAACCTCGGGGCTCTTTTACCGGCAAAGACATTATCAAGTTAAAATCGCAAGAATGGATGCCATCGCCGCCGACGAACAAACTCATGTTGTCAACCACTCCACCGATAGCGTAAGCCAACTATCTCCACCACTACAACCATTATCTAAAAGCGCACAGAAGAAGCTACTGAAGCAACAAAGATTCGAAGCCAAAAAAGCGGAGAAAAAAGCCGCCGTTAAAGAGGAGAAGAAACGACA...
1080 bp · LXL04_009960|LXL04_009960|OH1004|CDS
ATGTTCACTCTAAACAACCTATTAACCTCGGGGCTCTTTTACCGGCAAAGACATTATCAAGTTAAAATCGCAAGAATGGATGCCATCGCCGCCGACGAACAAACTCATGTTGTCAACCACTCCACCGATAGCGTAAGCCAACTATCTCCACCACTACAACCATTATCTAAAAGCGCACAGAAGAAGCTACTGAAGCAACAAAGATTCGAAGCCAAAAAAGCGGAGAAAAAAGCCGCCGTTAAAGAGGAGAAGAAACGACA...
Protein
Download Protein FASTA359 aa · LXL04_009960|LXL04_009960|OH1004|PROTEIN
MFTLNNLLTSGLFYRQRHYQVKIARMDAIAADEQTHVVNHSTDSVSQLSPPLQPLSKSAQKKLLKQQRFEAKKAEKKAAVKEEKKRQVERKRKEWEDKLSSLSEEEKLKMIETRKGMRKERMDQKTEERESKILRLSEAKKHGQKIVIDLQFSDLMAPNEIHSLVKQIMYCYAVNGRSPVPSNLWLTGYEGEIGNQLQNISGFNKWIIEKDSGPYINTFETQKENLVYLTADSETMLSDLDPKNIYIVGGLVDRNRCKGI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_009960 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_009960 |
|---|---|
| Location | Chr02:136769038-136770328 (+) |
| Description | Similar to trm10: tRNA (guanine(9)-N1)-methyltransferase (Schizosaccharomyces pombe (strain 972 / ATCC 24843) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0002939 tRNA N1-guanine methylation Biological Process GO:0010960 magnesium ion homeostasis Biological Process GO:0030488 tRNA methylation Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0015629 actin cytoskeleton Cellular Component GO:0070062 extracellular exosome Cellular Component GO:0000049 tRNA binding Molecular Function GO:0003723 RNA binding Molecular Function |
| KEGG gene cross-reference | bta:616544 hsa:93587 mmu:108943 spo:2543319 xtr:493374 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF27710.1TRM10_TRM10A54-319 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_009960 | PF27710.1 | TRM10_TRM10A | 54 | 319 | 8.9e-80 | 268.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.