LXL04_009875 | RubberDandelionOmics

Gene overview

LXL04_009875

Reference: OH-1004 Chr: Chr02 Coordinates: 135244706-135246435 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1309 bp · LXL04_009875|LXL04_009875|OH1004|cDNA

GAAAGAGGTCTTCACTATTGAAGCCTAAAACCCTTGCCGAGAAACCAGACATCGGAGGATCTCCCCCACTCTCCAAATGCTATCCCGTGTACTCTCTAAACCCTCGGCCCTCCGTCTTGTAGCCCTAATCTCATCATCTCAATCTCACTACAAGCATCACCATCCTCCCCTGATCCAAAACCCTACCTCTACCCTCTTCGCAATCAATCCTCGCTATTTTTCCGCCAATCGTGGAAATGGCAGTGAATCATCCGAGTACT...

CDS

Download CDS FASTA

1233 bp · LXL04_009875|LXL04_009875|OH1004|CDS

ATGCTATCCCGTGTACTCTCTAAACCCTCGGCCCTCCGTCTTGTAGCCCTAATCTCATCATCTCAATCTCACTACAAGCATCACCATCCTCCCCTGATCCAAAACCCTACCTCTACCCTCTTCGCAATCAATCCTCGCTATTTTTCCGCCAATCGTGGAAATGGCAGTGAATCATCCGAGTACTGGAAGATTTCCTCGGAAAATGAAGCCAGCATCGAATCTATATTCGGTAAGGACACCGGCAGCCTCGAAGGCATCGT...

Protein

Download Protein FASTA

410 aa · LXL04_009875|LXL04_009875|OH1004|PROTEIN

MLSRVLSKPSALRLVALISSSQSHYKHHHPPLIQNPTSTLFAINPRYFSANRGNGSESSEYWKISSENEASIESIFGKDTGSLEGIVGGEDAVRKSKEEEKSWFSMKEKEGNDEEDDIFKVIASEGKGTEDSGGDKLETGEGFKDWKFVVGDKNDGEGDDGLFDIGNAGVSELAESDVDEKVAIQKKEDDKLLEIEEKALTEVLKGPDHAFGDLIAASGITDEMLDSLMALKDLDDVPGLPSLSAIEDMRFEKNTRKSTR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009875`
TK1151 ID	TkA03G479640
OH-1004 ID	LXL04_009875
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009875

Location Chr02:135244706-135246435 (-)

Description Similar to RPS9M: 30S ribosomal protein S9, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g49080`	Mitochondrial ribosomal protein required for central cell maturation.	RPS9M, a Mitochondrial Ribosomal Protein, Is Essential for Central Cell Maturation and Endosperm Development in Arabidopsis.2017 · DOI: 10.3389/fpls.2017.02171

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009875 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0009555 pollen development Biological Process

GO:0009559 embryo sac central cell differentiation Biological Process

GO:0048229 gametophyte development Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0022627 cytosolic small ribosomal subunit Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003735 structural constituent of ribosome Molecular Function

KEGG gene cross-reference

ath:AT3G49080

bhe:BH07810

btr:BT_1476

nha:Nham_2454

rpd:RPD_2708

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.558

Rank 1 · LXL04_009875 · OH-1004

Plastid0.380

Rank 2 · LXL04_009875 · OH-1004

Nucleus0.068

Rank 3 · LXL04_009875 · OH-1004

Cytoplasm0.036

Rank 4 · LXL04_009875 · OH-1004

Cell membrane0.010

Rank 5 · LXL04_009875 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00380.26Ribosomal_S9289-410 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009875	`PF00380.26`	Ribosomal_S9	289	410	1.5e-44	152.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L6Z4`	Arabidopsis thaliana	Small ribosomal subunit protein uS9m	76.442%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card