Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2433 bp · LXL04_009749|LXL04_009749|OH1004|cDNA
ATGCCATGTTTGATTTCTTCAATCTCAAAGCAATATCGTTCTGGTGATGCACTGGAATCACAACGCTTCGCCATATTCTTGTTTCATGGATTATGCTGTTTAAATCCGGGCTCAGAAGTCGAGATGCAGCATTGGCGAATTACATTAACGAGATCTTTTGACAACGATGAAAAAAGCACAACCGGAGTGAGTAATCATCTGGTAAAGCAAAAGAAATCCTCGATTGAAATTATCGATTGTCGATTACGTGAACAATCTTC...
2433 bp · LXL04_009749|LXL04_009749|OH1004|CDS
ATGCCATGTTTGATTTCTTCAATCTCAAAGCAATATCGTTCTGGTGATGCACTGGAATCACAACGCTTCGCCATATTCTTGTTTCATGGATTATGCTGTTTAAATCCGGGCTCAGAAGTCGAGATGCAGCATTGGCGAATTACATTAACGAGATCTTTTGACAACGATGAAAAAAGCACAACCGGAGTGAGTAATCATCTGGTAAAGCAAAAGAAATCCTCGATTGAAATTATCGATTGTCGATTACGTGAACAATCTTC...
Protein
Download Protein FASTA810 aa · LXL04_009749|LXL04_009749|OH1004|PROTEIN
MPCLISSISKQYRSGDALESQRFAIFLFHGLCCLNPGSEVEMQHWRITLTRSFDNDEKSTTGVSNHLVKQKKSSIEIIDCRLREQSSGKAREIDDQGMSNSGLKQKTIKTLDNGNDIHGTELLIASNVCICSVLLLPISATESFIEQSNFRILKPPFSLISDFLSLRLRFCLKPPSVIINQQMMVYAHNNTKIIVEQTPLEVSVSPGLKKSNISLDQSFIEFEEYPDTFLDSLLNFEGWVEDHQNPSIPQVMNSDEKPSL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_009749 |
|---|---|
| TK1151 ID | TkA03G468340 |
| OH-1004 ID | LXL04_009749 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 93.800 |
| Protein coverage (%) | TK1151 91.987 / OH-1004 71.605Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_009749 |
|---|---|
| Location | Chr02:132564496-132568528 (-) |
| Description | Similar to NAF1: H/ACA ribonucleoprotein complex non-core subunit NAF1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000454 snoRNA guided rRNA pseudouridine synthesis Biological Process GO:0000493 box H/ACA snoRNP assembly Biological Process GO:0001522 pseudouridine synthesis Biological Process GO:0006364 rRNA processing Biological Process GO:0032212 positive regulation of telomere maintenance via telomerase Biological Process GO:0042254 ribosome biogenesis Biological Process GO:0043489 RNA stabilization Biological Process GO:0090669 telomerase RNA stabilization Biological Process GO:0090671 telomerase RNA localization to Cajal body Biological Process GO:1904358 positive regulation of telomere maintenance via telomere lengthening Biological Process GO:1905323 telomerase holoenzyme complex assembly Biological Process GO:0005634 nucleus Cellular Component |
| KEGG gene cross-reference | dme:Dmel_CG10341 hsa:92345 mmu:234344 rno:306387 spo:2540349 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF04410.21Gar1450-532 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_009749 | PF04410.21 | Gar1 | 450 | 532 | 3.7e-15 | 56.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.