LXL04_009684 | RubberDandelionOmics

Gene overview

LXL04_009684

Reference: OH-1004 Chr: Chr02 Coordinates: 131185446-131190057 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1800 bp · LXL04_009684|LXL04_009684|OH1004|cDNA

ATGATGATCAACAAGTCACTTTTCTTGACTTACCTTTACTTATTGATCTACATTTTGCTTTCATCTGGAGTTATTCTGTACAACAAGTGGGTTCTCTCTCCAAAGTACTTCAATTTTCCCTTTCCTATCACTCTCACCATGATCCACATGGGCTTTTCAGGAGCTGTAGCTTTCTTACTTGTTCGTGTTTTTAAGGTTGTTACTCCAGTTAAAATGACATTTGAAATATATGCAACATGTGTAGTTCCCATCAGTGCTTT...

CDS

Download CDS FASTA

1800 bp · LXL04_009684|LXL04_009684|OH1004|CDS

ATGATGATCAACAAGTCACTTTTCTTGACTTACCTTTACTTATTGATCTACATTTTGCTTTCATCTGGAGTTATTCTGTACAACAAGTGGGTTCTCTCTCCAAAGTACTTCAATTTTCCCTTTCCTATCACTCTCACCATGATCCACATGGGCTTTTCAGGAGCTGTAGCTTTCTTACTTGTTCGTGTTTTTAAGGTTGTTACTCCAGTTAAAATGACATTTGAAATATATGCAACATGTGTAGTTCCCATCAGTGCTTT...

Protein

Download Protein FASTA

599 aa · LXL04_009684|LXL04_009684|OH1004|PROTEIN

MMINKSLFLTYLYLLIYILLSSGVILYNKWVLSPKYFNFPFPITLTMIHMGFSGAVAFLLVRVFKVVTPVKMTFEIYATCVVPISAFFASSLWFGNTAYLHISVAFIQMLKALMPVATLIMAVLCGTDKLRWDVLLNMLLVSVGVVISSYGEIHFNVIGTLYQVTGIFAEALRLVLTQVLLQKKGLTLNPITSLYYIAPCSFAFLFIPWYLLEKSNMEVSQIQFNYWIFFSNALCALALNLSIFLVIGRTGAVTIRVAGV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009684`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009684

Location Chr02:131185446-131190057 (+)

Description Similar to At3g17430: Probable sugar phosphate/phosphate translocator At3g17430

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17430`	Probable sugar phosphate/phosphate translocator At3g17430.	No verified direct reference in this release
`At1g48230`	Probable sugar phosphate/phosphate translocator At1g48230.	No verified direct reference in this release
`At5g25400`	Probable sugar phosphate/phosphate translocator At5g25400.	No verified direct reference in this release
`At1g53660`	Probable sugar phosphate/phosphate translocator At1g53660.	No verified direct reference in this release
`At5g11230`	Probable sugar phosphate/phosphate translocator At5g11230.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009684 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015780 nucleotide-sugar transmembrane transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0015297 antiporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G48230

ath:AT1G53660

ath:AT3G17430

ath:AT5G11230

ath:AT5G25400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.648

Rank 1 · LXL04_009684 · OH-1004

Golgi apparatus0.148

Rank 2 · LXL04_009684 · OH-1004

Nucleus0.085

Rank 3 · LXL04_009684 · OH-1004

Cytoplasm0.081

Rank 4 · LXL04_009684 · OH-1004

Cell membrane0.077

Rank 5 · LXL04_009684 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03151.23TPT12-298 aa

PF00348.23polyprenyl_synt337-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009684	`PF03151.23`	TPT	12	298	1e-23	84.9
LXL04_009684	`PF00348.23`	polyprenyl_synt	337	411	9.6e-06	25.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LRP2`	Arabidopsis thaliana	Probable sugar phosphate/phosphate translocator At3g17430	85.758%	Swiss-Prot	moderate database homology
`Q9LNH5`	Arabidopsis thaliana	Probable sugar phosphate/phosphate translocator At1g48230	83.183%	Swiss-Prot	moderate database homology
`Q3E6T0`	Arabidopsis thaliana	Probable sugar phosphate/phosphate translocator At5g25400	47.840%	Swiss-Prot	moderate database homology
`Q9C8M1`	Arabidopsis thaliana	Probable sugar phosphate/phosphate translocator At1g53660	50.637%	Swiss-Prot	moderate database homology
`Q9LFN3`	Arabidopsis thaliana	Probable sugar phosphate/phosphate translocator At5g11230	49.074%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card