LXL04_009494 | RubberDandelionOmics

Gene overview

LXL04_009494

Reference: OH-1004 Chr: Chr02 Coordinates: 127370050-127374690 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1908 bp · LXL04_009494|LXL04_009494|OH1004|cDNA

ATGTCTAGATACTTAAACCGTGGTTATGGTTCCGACAACCATCTTAACTTCCGTAGGGATCCTATAGTCACCTATGATGTTCCTCAACCCAACAATGTCCACTTGGTATATGATGACAACCGCATCATGTTTGAGGAGGAGCGCCCTTTTGTTGGTTACCCTAACCGTGTAGTCTTTGAGGAACATCGTGTTAGTCCTATGCATAAACATTACCGCCATGGTTCAGTAGAGCCACGCAAGCATGTTCACTTTGTTGAGCA...

CDS

Download CDS FASTA

1908 bp · LXL04_009494|LXL04_009494|OH1004|CDS

ATGTCTAGATACTTAAACCGTGGTTATGGTTCCGACAACCATCTTAACTTCCGTAGGGATCCTATAGTCACCTATGATGTTCCTCAACCCAACAATGTCCACTTGGTATATGATGACAACCGCATCATGTTTGAGGAGGAGCGCCCTTTTGTTGGTTACCCTAACCGTGTAGTCTTTGAGGAACATCGTGTTAGTCCTATGCATAAACATTACCGCCATGGTTCAGTAGAGCCACGCAAGCATGTTCACTTTGTTGAGCA...

Protein

Download Protein FASTA

635 aa · LXL04_009494|LXL04_009494|OH1004|PROTEIN

MSRYLNRGYGSDNHLNFRRDPIVTYDVPQPNNVHLVYDDNRIMFEEERPFVGYPNRVVFEEHRVSPMHKHYRHGSVEPRKHVHFVEHDERVTESVDSFGNRKVHKESVDTIDNFGKEKVYKETIDTEADGFINRKHKNFELNKFGTFNSDFRFGKVPSPRVFTAQNSQSQLFTMEISTPMEISVQNVTNGDAPHDQTGVVPESAVSSSPAPAVAEDKFLISVEVCLKPSSTARIEDVKLAVERMLENRNLSYADGPVDIP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009494`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009494

Location Chr02:127370050-127374690 (-)

Description Similar to PCH2: Pachytene checkpoint protein 2 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g24710`	Plays a key role in chromosome recombination during meiosis.	Arabidopsis PCH2 Mediates Meiotic Chromosome Remodeling and Maturation of Crossovers.2015 · DOI: 10.1371/journal.pgen.1005372

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0479000`	Plays a key role in chromosome recombination during meiosis.	No verified direct reference in this release
`UniProt: A2XUN8`	Plays a key role in chromosome recombination during meiosis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009494 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006302 double-strand break repair Biological Process

GO:0007094 mitotic spindle assembly checkpoint signaling Biological Process

GO:0007129 homologous chromosome pairing at meiosis Biological Process

GO:0007130 synaptonemal complex assembly Biological Process

GO:0007131 reciprocal meiotic recombination Biological Process

GO:0007141 male meiosis I Biological Process

GO:0007144 female meiosis I Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0007286 spermatid development Biological Process

GO:0042138 meiotic DNA double-strand break formation Biological Process

GO:0051026 chiasma assembly Biological Process

GO:0051598 meiotic recombination checkpoint signaling Biological Process

KEGG gene cross-reference

ath:AT4G24710

dosa:Os04g0479000

mmu:69716

rno:292206

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.568

Rank 1 · LXL04_009494 · OH-1004

Nucleus0.358

Rank 2 · LXL04_009494 · OH-1004

Endoplasmic reticulum0.108

Rank 3 · LXL04_009494 · OH-1004

Cell membrane0.094

Rank 4 · LXL04_009494 · OH-1004

Mitochondrion0.091

Rank 5 · LXL04_009494 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23563.2TRIP13_N216-305 aa

PF13401.13AAA_22371-464 aa

PF13191.13AAA_16371-487 aa

PF00004.36AAA373-518 aa

PF23242.2AAA_lid_TRIP13_C521-629 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009494	`PF23563.2`	TRIP13_N	216	305	4.7e-28	97.9
LXL04_009494	`PF13401.13`	AAA_22	371	464	1.5e-07	32.5
LXL04_009494	`PF13191.13`	AAA_16	371	487	5.1e-07	31.1
LXL04_009494	`PF00004.36`	AAA	373	518	1.5e-27	97.3
LXL04_009494	`PF23242.2`	AAA_lid_TRIP13_C	521	629	2.1e-38	131.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H1F9`	Arabidopsis thaliana	Pachytene checkpoint protein 2 homolog	74.123%	Swiss-Prot	strong database homology
`Q7XK25`	Oryza sativa subsp. japonica	Pachytene checkpoint protein 2 homolog	72.158%	Swiss-Prot	moderate database homology
`A2XUN8`	Oryza sativa subsp. indica	Pachytene checkpoint protein 2 homolog	72.158%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card